Patent 5,273,889

Patent Title contains
   
All words Any words
Inventor contains
   
All words Any words

 

United States Patent 5,273,889
Potter ,   et al. December 28, 1993
**Please see images for: ( Certificate of Correction ) **

Gamma-iterferon-leukotoxin gene fusions and uses thereof

Abstract

New chimeric proteins, DNA encoding the same, and the use of these proteins in stimulating immunity against respiratory diseases such as pneumonia, including shipping fever pneumonia, are disclosed. The chimeric proteins include at least one epitope of leukotoxin fused to an active fragment of a cytokine. The chimeric proteins can be used in a vaccine composition. Also disclosed are methods of vaccination as well as methods of making the proteins employed in the vaccines.


Inventors: Potter; Andrew (Saskatoon, CA), Campos; Manuel (Saskatoon, CA), Hughes; Huw P. A. (Saskatoon, CA)
Assignee: University of Saskatchewan (Saskatoon, CA)
Ciba-Geigy Canada, Ltd. (Saskatoon, CA)
Family ID: 27075543
Appl. No.: 07/777,715
Filed: October 16, 1991

Related U.S. Patent Documents

Application NumberFiling DatePatent NumberIssue Date
571301Aug., 1990

Current U.S. Class: 435/69.51 ; 435/243; 435/252.3; 435/320.1; 435/69.5; 435/69.52; 435/69.7; 435/811; 536/23.1
Current International Class: C07K 14/195 (20060101); C07K 14/285 (20060101); C07K 14/435 (20060101); C07K 14/57 (20060101); C07K 14/55 (20060101); A61K 39/00 (20060101); C12N 015/23 (); C12N 015/19 (); C07H 015/12 ()
Current CPC Class: C07K 14/285 (20130101); C07K 14/55 (20130101); C07K 14/57 (20130101); A61K 39/00 (20130101); C07K 2319/55 (20130101); C07K 2319/61 (20130101); C07K 2319/75 (20130101)
Field of Search: 435/69.5,69.51,69.52,69.7,252.3,243,172.3,320.1,81 536/27,23.1

References Cited [Referenced By]

U.S. Patent Documents
3328252 June 1967 Mora
4167560 September 1979 Wohler, Jr.
4171354 October 1979 Smith
4328210 May 1982 Kucera
4346074 August 1982 Gilmour et al.
4366246 December 1982 Riggs
4675382 June 1987 Murphy
4704362 November 1987 Itakura et al.
4818769 April 1989 Nunberg et al.
4933299 June 1990 Greenfield
4935233 June 1990 Bell et al.
4957739 September 1990 Berget et al.
5028423 July 1991 Prickett
5071761 December 1992 Meyer et al.
5095096 March 1992 Miki et al.
5108910 April 1992 Curtis et al.
5114711 May 1992 Bell et al.
Foreign Patent Documents
008622 Sep., 1983 EP
0230119 Jul., 1987 EP
0369316 May., 1990 EP
0396387 Nov., 1990 EP
WO88/00971 Feb., 1988 WO
8800971 Feb., 1988 WO
8801004 Jan., 1991 WO

Other References

Cho et al., Can. J. Vet. Res. (1986) 50:27-31. .
Cho et al., Can. J. Comp. Med. (1984) 48:151-155. .
Donanche et al., J. Gen. Microbiol. (1984) 130:1209-1216. .
Gentry et al., Vet. Immunology and Immunopathology (1985) 9: 239-250. .
Himmel et al., Am. J. Vet. Res. (1982) 43:764-767. .
Lawman et al., "Recombinant Cytokines and their Potential Therapeutic Value in Veterinary Medicine" (1989) Comprehensive Biotech, First Supplement, Animal Biotechnology Pergamon Press, London, pp. 63-106. .
Lessley et al., Veterinary Immunology and Immunopathology (1985) 10:279-296. .
Lo et al., Infect. Immun. (1985) 50:667-671. .
Martin et al., Can. J. Comp. Med. (1980) 44:1-10. .
Shewen et al., Am. J. Vet. Res. (1983) 44:715-719. .
Shewen et al., Can. J. Vet. Res. (1988) 52:30-36. .
Strathdee et al., Infect. Immun. (1987) 55:(12)3233-3236. .
Yates Can. J. Comp. Med. (1982) 46:225-263. .
Conlon et al., Infect. Immun. (1991) 59(2):587-591. .
Czarniecki et al., J. Interferon Res. (1986) 6:29-37. .
Highlander et al., DNA (1989) 8:15-28. .
Lally et al., Biochem. Biophys. Res. Comm. (1989) 159(1):256-262. .
Lorberboum-Galski et al., Proc. Natl. Acad. Sci. USA (1988) 85:1922-1926. .
Strathdee et al., J. Bacteriol. (1989) 171(2)916-928. .
Williams et al. Protein Eng. (1987) 1(6):493-498..

Primary Examiner: Draper; Garnette D.
Attorney, Agent or Firm: Reed & Robins

Parent Case Text



CROSS-REFERENCE TO RELATED APPLICATION

This application is a continuation-in-part of U.S. Patent application Ser. No. 07/571,301, filed Aug. 22, 1990 from which priority is claimed under 35 USC .sctn.120 and which is incorporated herein by reference in its entirety.
Claims



We claim:

1. A DNA construct comprising a first nucleotide sequence encoding gamma-interferon (.gamma.IFN), operably linked to a second nucleotide sequence encoding an immunogenic leukotoxin, wherein said leukotoxin is characterized by having the amin acid sequence G-G-X-G-X-D (SEQ ID NO. 3) where X is K, D, V or N.

2. The DNA construct of claim 1 wherein said .gamma.IFN is bovine .gamma.IFN.

3. The DNA construct of claim 2 comprising the nucleotide sequence depicted in FIG. 7 (SEQ ID NO. 3).

4. The DNA construct of claim 1 wherein said leukotoxin is a P. haemolytica leukotoxin.

5. The DNA construct of claim 1 wherein said leukotoxin is a truncated leukotoxin as present in plasmid pAA352 (ATCC Accession No. 68283).

6. An expression cassette comprised of:

(a) the DNA construct of claim 1; and

(b) control sequences that direct the transcription of said construct whereby said construct can be transcribed and translated in a host cell.

7. A vector comprising a DNA construct encoding a gamma-interferon-leukotoxin fusion protein, wherein the plasmid is pAA497.

8. A host cell stably transformed with the expression cassette of claim 6.

9. A host cell stably transformed with the vector of claim 7.

10. A method of producing a recombinant polypeptide comprising:

(a) providing a population of host cells according to claim 8;

(b) growing said population of cells under conditions whereby the polypeptide encoded by said expression cassette is expressed; and

(c) isolating the expressed polypeptide.

11. A method of producing a recombinant polypeptide comprising:

(a) providing a population of host cells according to claim 9;

(b) growing said population of cells under conditions whereby the polypeptide encoded by said expression cassette is expressed; and

(c) isolating the expressed polypeptide.
Description



DESCRIPTION

1. Technical Field

The present invention relates generally to subunit antigens, vaccine compositions, and methods of administering the same. More particularly, the present invention relates to cytokine-leukotoxin gene fusion products and the use of the same for stimulating immunity against pneumonia.

2. Background of the Invention

Respiratory disease affecting feedlot cattle causes tremendous losses yearly to the cattle industry. Calves are the most severely affected, and a large number of these calves die. This disease is associated with pathogenic microorganisms, particularly Pasteurallae species, and various stresses, such as transportation and overcrowding.

Shipping fever is the most economically important respiratory disease associated with Pasteurella species. The disease is characterized by sudden onset, usually within two weeks of stress. The symptoms include dyspnea, cough, ocular and nasal discharge, inappetence and rapid weight loss, fever, increased lung sounds, immunosuppression, general depression, viral and/or bacterial infection of the lungs. Various bacteria and viruses have been isolated from affected animals including Pasteurella spp., bovine herpes virus 1, parainfluenza-3 virus, bovine respiratory syncytial virus and Mycoplasma species. The disease typically affects 15-30% of exposed animals and the resulting deaths are typically 2-5% of the exposed population.

Exposure of the animal to stress, plus infection with a variety of viruses, as described above, appears to make the animal susceptible to fibrinous pneumonia caused by P. haemolytica, and to a lesser extent, Pasteurella multocida. For a general background on shipping fever see Yates, W.D.G. (1982) Can. J. Comp. Med. 46:225-263.

P. haemolytica also causes enzootic pneumonia and can infect a wide range of animals, in addition to cattle, including economically important species such as sheep, swine, horses and fowl. P. haemolytica is also frequently found in the upper respiratory tract of healthy animals. Pneumonia develops when the bacteria infect the lungs of these animals. Protection against Pasteurella-associated diseases is therefore economically important to the agricultural industry.

There are two known biotypes of P. haemolytica designated A and T. There are also 12 recognized serotypes which have been isolated from ruminants. Biotype A, serotype 1 (referred to hereinafter as "A1") predominates in bovine pneumonia in North America. Shewen, P.E., and Wilkie, B.N. (1983) Am. J. Vet. Res. 44:715-719. However, antigens isolated from different serotypes appear to be somewhat cross-reactive. See, e.g., Donanchie et al. (1984) J. Gen. Micro. 130:1209-1216.

Previous Pasteurellosis vaccines have utilized whole cell preparations of either live or heat killed bacteria of various serotypes as described in U.S. Pat. Nos. 4,328,210, 4,171,354, 3,328,252, 4,167,560 and 4,346,074. Traditional vaccine preparations, however, have not been effective in protecting against Pasteurella infections. Indeed, vaccinated animals are frequently more susceptible to the disease than their non-vaccinated counterparts. Martin et al. (1980) Can. J. Comp. Med. 44:1-10. The lack of protection offered by traditional vaccines is probably due to the absence of important antigens, virulence determinants, or the presence of immunosuppressive components in the preparations.

Other vaccine preparations have included crude supernatant extracts from P. haemolytica. See. e.g., Shewen, P.E., and Wilkie, B.N. (1988) in Can. J. Vet. Res. 52:30-36. These culture supernatants, however, contain various soluble surface antigens of the bacterium and produce variable results when administered to animals. Other preparations include capsular extracts obtained via sodium salicylate extraction (see. e.g., Donanchie et al. (1984) 130:1209-1216; U.S. Pat. No. 4,346,074), saline extracted antigens (see. e.g., Lessley et al. (1985) Veterinary Immunology and Immunopathology 10:279-296; Himmel et al. (1982) Am. J. Vet. Res. 43:764-767), and modified live Pasteurella mutants.

Still other attempts at immunization have included the use of a purified cytotoxin from P. haemolytica. See, e.g., Gentry et al. (1985) Vet. Immunology and Immunopathology 9:239-250. This cytotoxin, which is a leukotoxin, is secreted by actively growing bacteria. Shewen, P.E., and Wilkie, B.N. (1987) Infect. Immun. 55:3233-3236. The gene encoding this leukotoxin has been cloned and expressed in bacterial cells. Lo et al. (1985) Infect. Immun. 50:667-671. Calves which survive P. haemolytica infections possess toxin-neutralizing antibody. Cho, H.J., and Jericho, K.W.F. (1986) Can. J. Vet. Res. 50:27-31; Cho et al. (1984) Can. J. Como. Med. 48:151-155.

Cytokines are a group of hormone-like mediators produced by leukocytes. Cytokines serve as endogenous signals that act in conjunction with antigens to amplify both localized and systemic host defense mechanisms involving macrophages, lymphocytes, and other cell types. Representative lympokines include interleukin-1 (IL1), interleukin-2 (IL2), interleukin-3 (IL3), interleukin-4 (IL4), and gamma-interferon (.gamma.IFN).

IL1 and IL2 both exhibit thymocyte mitogenic activity and IL2 stimulates T lymphocyte proliferation. IL3 stimulates the growth of hematopoietic progenitor cells and multipotential stem cells, and IL4 acts as an induction factor on resting B cells and as a B cell growth and differentiation factor. IL4 also exhibits T cell stimulatory activity.

.gamma.IFN is predominantly produced by antigen- or mitogen-stimulated T lymphocytes. .gamma.IFN has been shown to be a potent immunomodulator and appears to enhance natural killer cell activity, antibody-dependent cellular cytotoxicity, and cytotoxic T lymphocyte activity (Lawman et al. (1989) "Recombinant Cytokines and their Potential Therapeutic Value in Veterinary Medicine" in Comprehensive Biotech, First Supplement Animal Biotechnology, Pages 63-106 (Pergamon Press, London).

Gene fusions provide a convenient method for the production of chimeric proteins. The expression of a chimeric protein, such as a cytokine linked to an antigenic polypeptide, allows the simultaneous delivery of both agents to a desired recipient. PCT Publication No. WO 88/00971 (publication date of Feb. 11, 1988) describes the fusion of an IL2 gene with the influenza hemagglutinin coding sequence and the subsequent administration of the fusion protein using a viral vector. The application nowhere contemplates the use of a cytokine fused to leukotoxin for the treatment of pneumonia in animals.

Disclosure of the Invention

The present invention is based on the construction of novel gene fusions between sequences encoding certain cytokines and the P. haemolytica leukotoxin gene. These constructs produce fusion proteins that can be used to protect cattle and other animals from respiratory diseases such as pneumonia, including shipping fever pneumonia.

In one embodiment, the present invention is directed to a DNA construct comprising a first nucleotide sequence encoding a cytokine, or an active fragment thereof, operably linked to a second nucleotide sequence encoding at least one epitope of leukotoxin. In particularly preferred embodiments, the first nucleotide sequence encodes IL2 or .gamma.IFN, or active fragments thereof.

In another embodiment, the subject invention is directed to expression cassettes comprised of (a) the DNA constructs above and (b) control sequences that direct the transcription of the constructs whereby the constructs can be transcribed and translated in a host cell.

In yet another embodiment, the instant invention is directed to expression plasmids pAA356 and pAA497.

In another embodiment, the invention is directed to host cells transformed with these expression cassettes.

Another embodiment of the invention provides a method of producing a recombinant polypeptide comprising (a) providing a population of host cells described above and (b) growing the population of cells under conditions whereby the polypeptide encoded by the expression cassette is expressed.

In still another embodiment, the invention is directed to an immunogenic chimeric protein comprising a cytokine, or an active fragment thereof, linked to at least one epitope of leukotoxin. In particularly preferred embodiments, the cytokine is derived from bovine IL2 or bovine .gamma.IFN.

Also disclosed are vaccine compositions comprising the chimeric proteins and a pharmaceutically acceptable vehicle and methods of vaccinating a subject using the same.

These and other embodiments of the present invention will readily occur to those of ordinary skill in the art in view of the disclosure herein.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 depicts the structure of the leukotoxin gene of P. haemolytica cloned in E. coli (Plasmid pAA114).

FIG. 2 shows the structure of plasmid pAA356 carrying a bovine IL2-leukotoxin (IL2-LKT) gene fusion wherein tac is the hybrid trp::lac promoter from E. coli; bla represents the .beta.-lactamase gene (ampicillin resistance); 1ktA is the P. haemolytica leukotoxin structural gene; IL2 is the bovine interleukin-2 structural gene; and lac1 is the E. coli lac operon repressor.

FIGS. 3A-3K is the nucleotide sequence and predicted amino acid sequence of the bovine IL2-LKT chimeric protein from pAA356.

FIGS. 4A-4C depicts the changes in IgG anti-LKT in nonimmunized calves (FIG. 4A), LKT-immunized calves (FIG. 4B), and calves immunized with an IL2-LKT fusion protein (FIG. 4C).

FIG. 5 shows precursor frequency analysis of PBMC responding to recombinant bovine IL2-LKT chimeric protein.

FIG. 6 shows the structure of plasmid pAA497 carrying a bovine .gamma.IFN-LKT gene fusion wherein tac is the hybrid trp::lac promoter from E. coli; bla represents the .beta.-lactamase gene (ampicillin resistance); 1ktA is the P. haemolytica leukotoxin structural gene; IFN is the bovine gamma-interferon structural gene; and lac1 is the E. coli lac operon repressor,

FIGS. 7A-7L is the nucleotide sequence and predicted amino acid sequence of the bovine .gamma.IFN-LKT chimeric protein from pAA497.

DETAILED DESCRIPTION

The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology, microbiology, virology, recombinant DNA technology, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature. See. e.g., Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, Second Edition (1989); Maniatis, Fritsch & Sambrook, Molecular Cloning: A Laboratory Manual (1982); DNA Cloning, Vols. I and II (D.N. Glover ed. 1985); Oligonucleotide Synthesis (M.J. Gait ed. 1984); Nucleic Acid Hybridization (B.D. Hames & S.J. Higgins eds. 1984); Animal Cell Culture (R.K. Freshney ed. 1986); Immobilized Cells and Enzymes (IRL press, 1986); B. Perbal, A Practical Guide to Molecular Cloning (1984); the series, Methods In Enzymology (S. Colowick and N. Kaplan eds., Academic Press, Inc.); and Handbook of Experimental Immunology, Vols. I-IV (D.M. Weir and C.C. Blackwell eds., 1986, Blackwell Scientific Publications).

All patents, patent applications, and publications mentioned herein, whether supra or infra, are hereby incorporated by reference in their entirety.

A. DEFINITIONS

In describing the present invention, the following terms will be employed, and are intended to be defined as indicated below.

By "cytokine" is meant any one of the group of hormone-like mediators produced by T and B lymphocytes. Representative cytokines include but are not limited to IL1, IL2, IL3, IL4 and .gamma.IFN. An "active" fragment of a cytokine is a fragment of a cytokine which retains activity as determined using standard in vitro and in vivo assays. For example, assays for determining IL2 and .gamma.IFN activity are described in the Examples. See also Campos, M. (1989) Cell. Immun. 120:259-269 and Czarniecki, C.W. (1986) J. Interferon Res. 6:29-37. Assays for determining the activity of other cytokines are known and can readily be conducted by those having ordinary skill in the art.

An "antigen" refers to a molecule containing one or more epitopes that will stimulate a host's immune system to make a humoral and/or cellular antigen-specific response. The term is also used interchangeably with "immunogen."

A "hapten" is a molecule containing one or more epitopes that does not stimulate a host's immune system to make a humoral or cellular response unless linked to a carrier.

The term "epitope" refers to the site on an antigen or hapten to which a specific antibody molecule binds. The term is also used interchangeably with "antigenic determinant" or "antigenic determinant site."

An "immunological response" to a composition or vaccine is the development in the host of a cellular and/ or antibody-mediated immune response to the composition or vaccine of interest. Usually, such a response consists of the subject producing antibodies, B cells, helper T cells, suppressor T cells, and/or cytotoxic T cells directed specifically to an antigen or antigens included in the composition or vaccine of interest.

An "immunogenic polypeptide" or "immunogenic amino acid sequence" is a polypeptide or amino acid sequence, respectively, which elicits an immunological response in a subject to which it is administered.

The term "protein" is used herein to designate a naturally occurring polypeptide. The term "polypeptide" is used in its broadest sense, i.e., any polymer of amino acids (dipeptide or greater) linked through peptide bonds. Thus, the term "polypeptide" includes proteins, oligopeptides, protein fragments, analogs, muteins, fusion proteins and the like.

"Native" proteins or polypeptides refer to proteins or polypeptides recovered from a source occurring in nature. Thus, the term "native leukotoxin" would include naturally occurring leukotoxin and fragments thereof.

"Recombinant" polypeptides refer to polypeptides produced by recombinant DNA techniques; i.e., produced from cells transformed by an exogenous DNA construct encoding the desired polypeptide. "Synthetic" polypeptides are those prepared by chemical synthesis.

A "rotavirus VP6 protein" refers to the art-recognized major viral protein of the inner capsid from any species or strain within the family Reoviridae. See, e.g., Kapikian et al., 1985. Examples of rotavirus strains from which the VP6 protein can be isolated and employed in the present invention include, but are not limited to, Simian SA-11, human D rotavirus, bovine UK rotavirus, human Wa or W rotavirus, human DS-1 rotavirus, rhesus rotavirus, the "O" agent, bovine NCDV rotavirus, human S2 rotavirus, human KUN rotavirus, human 390 rotavirus, human P rotavirus, human M rotavirus, human Walk 57/14 rotavirus, human Mo rotavirus, human Ito rotavirus, human Nemoto rotavirus, human YO rotavirus, human McM2 rotavirus, rhesus monkey MMU18006 rotavirus, canine CU-1 rotavirus, feline Taka rotavirus, equine H-2 rotavirus, human St. Thomas No. 3 and No. 4 rotaviruses, human Hosokawa rotavirus, human Hochi rotavirus, porcine SB-2 rotavirus, porcine Gottfried rotavirus, porcine SB-1A rotavirus, porcine OSU rotavirus, equine H-1 rotavirus, chicken Ch.2 rotavirus, turkey Ty.1 rotavirus, bovine C486 rotavirus, and strains derived from them. Thus the present invention encompasses the use of VP6 from any rotavirus strain, whether from subgroup I, subgroup II, or any as yet unidentified subgroup, as well as from any of the serotypes 1-7, as well as any as yet unidentified serotypes. Such VP6 proteins can be used as immunologic carriers of polypeptides. These carrier molecules comprise amino acid sequences of rotavirus VP6 amino acid sequences which are unique to the class, or any member of the class, of VP6 polypeptides. Such unique sequences of VP6 proteins are referred to as a "rotavirus VP6 inner capsid protein amino acid sequence."

A carrier that is "substantially homologous to a rotavirus VP6 inner capsid protein or a functional fragment thereof" is one in which at least about 85%, preferably at least about 90%, and most preferably at least about 95%, of the amino acids match over a defined length of the molecule. A "functional fragment" of a rotavirus VP6 inner capsid protein is a fragment with the capability of acting as a carrier molecule for the novel chimeric proteins of the instant invention.

A "replicon" is any genetic element (e.g., plasmid, chromosome, virus) that functions as an autonomous unit of DNA replication in vivo; i.e., capable of replication under its own control.

A "vector" is a replicon, such as a plasmid, phage, or cosmid, to which another DNA segment may be attached so as to bring about the replication of the attached segment.

A "double-stranded DNA molecule" refers to the polymeric form of deoxyribonucleotides (bases adenine, guanine, thymine, or cytosine) in a double-stranded helix, both relaxed and supercoiled. This term refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes double-stranded DNA found, inter alia, in linear DNA molecules (e.g., restriction fragments), viruses, plasmids, and chromosomes. In discussing the structure of particular double-stranded DNA molecules, sequences may be described herein according to the normal convention of giving only the sequence in the 5' to 3' direction along the nontranscribed strand of DNA (i.e., the strand having the sequence homologous to the mRNA).

A DNA "coding sequence" or a "nucleotide sequence encoding" a particular protein, is a DNA sequence which is transcribed and translated into a polypeptide in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxy) terminus. A coding sequence can include, but is not limited to, procaryotic sequences, cDNA from eucaryotic mRNA, genomic DNA sequences from eucaryotic (e.g., mammalian) DNA, and even synthetic DNA sequences. A transcription termination sequence will usually be located 3' to the coding sequence.

A "promoter sequence" is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3' direction) coding sequence. For purposes of defining the present invention, the promoter sequence is bound at the 3' terminus by the translation start codon (ATG) of a coding sequence and extends upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. Within the promoter sequence will be found a transcription initiation site (conveniently defined by mapping with nuclease S1), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase. Eucaryotic promoters will often, but not always, contain "TATA" boxes and "CAT" boxes. Procaryotic promoters contain Shine-Dalgarno sequences in addition to the -10 and -35 consensus sequences.

DNA "control sequences" refer collectively to promoter sequences, ribosome binding sites, polyadenylation signals, transcription termination sequences, upstream regulatory domains, enhancers, and the like, which collectively provide for the transcription and translation of a coding sequence in a host cell.

A coding sequence is "operably linked to" another coding sequence when RNA polymerase will transcribe the two coding sequences into mRNA, which is then translated into a chimeric polypeptide encoded by the two coding sequences. The coding sequences need not be contiguous to one another so long as the transcribed sequence is ultimately processed to produce the desired chimeric protein.

A control sequence "directs the transcription" of a coding sequence in a cell when RNA polymerase will bind the promoter sequence and transcribe the coding sequence into mRNA, which is then translated into the polypeptide encoded by the coding sequence.

A "host cell" is a cell which has been transformed, or is capable of transformation, by an exogenous DNA sequence.

A cell has been "transformed" by exogenous DNA when such exogenous DNA has been introduced inside the cell membrane. Exogenous DNA may or may not be integrated (covalently linked) to chromosomal DNA making up the genome of the cell. In procaryotes and yeasts, for example, the exogenous DNA may be maintained on an episomal element, such as a plasmid. With respect to eucaryotic cells, a stably transformed cell is one in which the exogenous DNA has become integrated into the chromosome so that it is inherited by daughter cells through chromosome replication. This stability is demonstrated by the ability of the eucaryotic cell to establish cell lines or clones comprised of a population of daughter cell containing the exogenous DNA.

A "clone" is a population of cells derived from a single cell or common ancestor by mitosis. A "cell line" is a clone of a primary cell that is capable of stable growth in vitro for many generations.

Two DNA or polypeptide sequences are "substantially homologous" when at least about 80% (preferably at least about 90%, and most preferably at least about 95%) of the nucleotides or amino acids match over a defined length of the molecule. DNA sequences that are substantially homologous can be identified in a Southern hybridization experiment under, for example, stringent conditions, as defined for that particular system. Defining appropriate hybridization conditions is within the skill of the art. See, e.g.. Sambrook et al., supra; DNA Cloning, vols. I & II, supra; Nucleic Acid Hybridization, supra. A "substantially homologous" sequence also intends a sequence that encodes a protein which is functionally equivalent to the depicted sequences. By "functionally equivalent" is meant that the amino acid sequence of the subject fusion protein is one that will elicit an immunological response, as defined above, equivalent to the response elicited by the unmodified chimeric protein.

A "heterologous" region of a DNA construct is an identifiable segment of DNA within or attached to another DNA molecule that is not found in association with the other molecule in nature. Thus, when the heterologous region encodes a bacterial gene, the gene will usually be flanked by DNA that does not flank the bacterial gene in the genome of the source bacteria. Another example of the heterologous coding sequence is a construct where the coding sequence itself is not found in nature (e.g., synthetic sequences having codons different from the native gene). Allelic variation or naturally occurring mutational events do not give rise to a heterologous region of DNA, as used herein.

A composition containing A is "substantially free of" B when at least about 85% by weight of the total of A+B in the composition is A. Preferably, A comprises at least about 90% by weight of the total of A +B in the composition, more preferably at least about 95%, or even 99% by weight.

The term "treatment" as used herein refers to either (i) the prevention of infection or reinfection (prophylaxis), or (ii) the reduction or elimination of symptoms or the disease of interest (therapy).

B. GENERAL METHODS

Central to the instant invention is the production of a chimeric protein comprising a cytokine and a P. haemolytica leukotoxin. This chimeric protein can be used in a vaccine composition to protect animals against respiratory diseases such as pneumonia, including shipping fever pneumonia.

Actively growing cells of P. haemolytica have been shown to secrete leukotoxin which can be cloned, the gene encoding the same isolated, and fused with a gene encoding an appropriate cytokine. The resulting chimeric proteins can be expressed and used to immunize subjects against shipping fever.

The nucleotide sequence coding for P. haemolytica A1 leukotoxin has been determined. See, e.g., Lo, R.Y.C. (1987) Infect. Immun. 55:1987-1996. Of interest is the fact that the P. haemolytica leukotoxin gene and the corresponding protein share extensive homology with Escherichia coli alpha hemolysin (50.3% of the amino acid residues are identical). Strathdee, C.A., and Lo, R.Y.C. (1987) Infect. Immun. 55:3233-3236. P. haemolytica leukotoxin can be produced using recombinant techniques and purified from, for example, bacterial cells. The leukotoxin can also be purified from native bacteria using immunoadsorbent chromatography. The molecular weight of the purified leukotoxin is approximately 95,000 and the isoelectric point is 6.3.

Similarly, the coding sequences for numerous cytokines have been elucidated. See, e.g., published EPA 088,622 and EPA 230,119 (both describing sequences for bovine .gamma.IFN); Maliszewski et al. (1988) Molec. Immun. 5 25:429-437 and Ceretti et al. (1986) Proc. Natl. Acad. Sci., U.S.A. 83:2332-2337. Again, these cytokines can be purified using standard techniques.

Purification of the above proteins as described herein permits the sequencing of the same by any of the various methods known to those skilled in the art. For example, the amino acid sequences of the subject proteins can be determined from the purified proteins by repetitive cycles of Edman degradation, followed by amino acid analysis by HPLC. Other methods of amino acid sequencing are also known in the art. Furthermore, fragments of the proteins can be tested for biological activity and active fragments used in compositions in lieu of the entire protein.

Once the amino acid sequences are determined, oligonucleotide probes which contain the codons for a portion of the determined amino acid sequences can be prepared and used to screen DNA libraries for genes encoding the subject proteins. The basic strategies for preparing oligonucleotide probes and DNA libraries, as well as their screening by nucleic acid hybridization, are well known to those of ordinary skill in the art. See. e.g., DNA Cloning: Vol. I, supra; Nucleic Acid Hybridization, supra; Oligonucleotide Synthesis, supra; Sambrook et al., supra.

First, a DNA library is prepared. The library can consist of a genomic DNA library from P. haemolytica (for the isolation of the leukotoxin gene) or from appropriate T cells (for the isolation of the desired cytokine gene). Once the library is constructed, oligonucleotides to probe the library are prepared and used to isolate the gene encoding the desired protein. The oligonucleotides are synthesized by any appropriate method. The particular nucleotide sequences selected are chosen so as to correspond to the codons encoding a known amino acid sequence from the desired protein. Since the genetic code is degenerate, it will often be necessary to synthesize several oligonucleotides to cover all, or a reasonable number, of the possible nucleotide sequences which encode a particular region of the protein. Thus, it is generally preferred in selecting a region upon which to base the probes, that the region not contain amino acids whose codons are highly degenerate. In certain circumstances, it may be desirable to prepare probes that are fairly long, and/or encompass regions of the amino acid sequence which would have a high degree of redundancy in corresponding nucleic acid sequences, particularly if this lengthy and/or redundant region is highly characteristic of the protein of interest. It may also be desirable to use two probes (or sets of probes), each to different regions of the gene, in a single hybridization experiment. Automated oligonucleotide synthesis has made the preparation of large families of probes relatively straightforward. While the exact length of the probe employed is not critical, generally it is recognized in the art that probes from about 14 to about 20 base pairs are usually effective. Longer probes of about 25 to about 60 base pairs are also used.

The selected oligonucleotide probes are labeled with a marker, such as a radionucleotide or biotin using standard procedures. The labeled set of probes is then used in the screening step, which consists of allowing the single-stranded probe to hybridize to isolated ssDNA from the library, according to standard techniques. Either stringent or permissive hybridization conditions could be appropriate, depending upon several factors, such as the length of the probe and whether the probe is derived from the same species as the library, or an evolutionarily close or distant species. The selection of the appropriate conditions is within the skill of the art. See, generally, Nucleic Acid hybridization, supra. The basic requirement is that hybridization conditions be of sufficient stringency so that selective hybridization occurs; i.e., hybridization is due to a sufficient degree of nucleic acid homology (e.g., at least about 75%), as opposed to nonspecific binding. Once a clone from the screened library has been identified by positive hybridization, it can be confirmed by restriction enzyme analysis and DNA sequencing that the particular library insert contains a gene for the desired protein.

Alternatively, DNA sequences encoding the proteins of interest can be prepared synthetically rather than cloned. The DNA sequence can be designed with the appropriate codons for the particular amino acid sequence. In general, one will select preferred codons for the intended host if the sequence will be used for expression. The complete sequence is assembled from overlapping oligonucleotides prepared by standard methods and assembled into a complete coding sequence. See. e.g., Edge (1981) Nature 292:756; Nambair et al. (1984) Science 223:1299; Jay et al. (1984) J. Biol. Chem. 259:6311.

Once coding sequences for the desired proteins have been prepared or isolated, they can be cloned into any suitable vector or replicon. Numerous cloning vectors are known to those of skill in the art, and the selection of an appropriate cloning vector is a matter of choice. Examples of recombinant DNA vectors for cloning and host cells which they can transform include the bacteriophage lambda (E. coli), pBR322 (E. coli), pACYC177 (E. coli), pKT230 (gram-negative bacteria), pGV1106 (gram-negative bacteria), pLAFR1 (gram-negative bacteria), pME290 (non-E. coli gram-negative bacteria), pHV14 (E. coli and Bacillus subtilis), pBD9 (Bacillus), pIJ61 (Streptomyces), pUC6 (Streptomyces), YIp5 (Saccharomyces), YCp19 (Saccharomyces) and bovine papilloma virus (mammalian cells). See, generally, DNA Cloning: Vols. I and II, supra; T. Maniatis et al., supra; B. Perbal, supra.

Suitable restriction enzymes can then be employed to isolate the appropriate cytokine gene or leukotoxin gene and these sequences can be ligated together, using standard techniques (see. e.g., Sambrook et al., supra) and cloned to form a cytokine-leukotoxin fusion gene.

The fusion gene can be placed under the control of a promoter, ribosome binding site (for bacterial expression) and, optionally, an operator (collectively referred to herein as "control" elements), so that the DNA sequence encoding the chimeric protein is transcribed into RNA in the host cell transformed by a vector containing this expression construction. The coding sequence may or may not contain a signal peptide or leader sequence. The chimeric proteins of the present invention can be expressed using, for example, native P. haemolytica promoter, the E. coli tac promoter or the protein A gene (spa) promoter and signal sequence. Leader sequences can be removed by the bacterial host in post-translational processing. See. e.g., U.S. Pat. Nos. 4,431,739; 4,425,437; 4,338,397.

In addition to control sequences, it may be desirable to add regulatory sequences which allow for regulation of the expression of the protein sequences relative to the growth of the host cell. Regulatory sequences are known to those of skill in the art, and examples include those which cause the expression of a gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound. Other types of regulatory elements may also be present in the vector, for example, enhancer sequences.

An expression vector is constructed so that the particular fusion coding sequence is located in the vector with the appropriate regulatory sequences, the positioning and orientation of the coding sequence with respect to the control sequences being such that the coding sequence is transcribed under the "control" of the control sequences (i.e., RNA polymerase which binds to the DNA molecule at the control sequences transcribes the coding sequence). Modification of the sequences encoding the particular chimeric protein of interest may be desirable to achieve this end. For example, in some cases it may be necessary to modify the sequence so that it may be attached to the control sequences with the appropriate orientation; i.e., to maintain the reading frame. The control sequences and other regulatory sequences may be ligated to the coding sequence prior to insertion into a vector, such as the cloning vectors described above. Alternatively, the coding sequence can be cloned directly into an expression vector which already contains the control sequences and an appropriate restriction site.

In some cases, it may be desirable to add sequences which cause the secretion of the polypeptide from the host organism, with subsequent cleavage of the secretory signal. It may also be desirable to produce mutants or analogs of the chimeric proteins of interest. Mutants or analogs may be prepared by the deletion of a portion of the sequence encoding the protein, by insertion of a sequence, and/or by substitution of one or more nucleotides within the sequence. Techniques for modifying nucleotide sequences, such as site-directed mutagenesis, are well known to those skilled in the art. See, e.g., T. Maniatis et al., supra; DNA Cloning, Vols. I and II, supra; Nucleic Acid Hybridization, supra.

A number of procaryotic expression vectors are known in the art. See, e.g., U.S. Pat. Nos. 4,440,859; 4,436,815; 4,431,740; 4,431,739; 4,428,941; 4,425,437; 4,418,149; 4,411,994; 4,366,246; 4,342,832; see also U.K. Patent Applications GB 2,121,054; GB 2,008,123; GB 2,007,675; and European Patent Application 103,395. Yeast expression vectors are also known in the art. See, e.g., U.S. Pat. Nos. 4,446,235; 4,443,539; 4,430,428; see also European Patent Applications 103,409; 100,561; 96,491.

Depending on the expression system and host selected, the proteins of the present invention are produced by growing host cells transformed by an expression vector described above under conditions whereby the protein of interest is expressed. The chimeric protein is then isolated from the host cells and purified. If the expression system secretes the protein into growth media, the protein can be purified directly from the media. If the protein is not secreted, it is isolated from cell lysates. The selection of the appropriate growth conditions and recovery methods are within the skill of the art.

An alternative method to identify proteins of the present invention is by constructing gene libraries, using the resulting clones to transform E. coli and pooling and screening individual colonies using polyclonal serum or monoclonal antibodies to the desired antigen.

The chimeric proteins of the present invention may also be produced by chemical synthesis such as solid phase peptide synthesis, using known amino acid sequences or amino acid sequences derived from the DNA sequence of the genes of interest. Such methods are known to those skilled in the art. Chemical synthesis of peptides may be preferable if a small fragment of the antigen in question is capable of raising an immunological response in the subject of interest.

The proteins of the present invention or their fragments can be used to produce antibodies, both polyclonal and monoclonal. If polyclonal antibodies are desired, a selected mammal, (e.g., mouse, rabbit, goat, horse, etc.) is immunized with an antigen of the present invention, or its fragment, or a mutated antigen. Serum from the immunized animal is collected and treated according to known procedures. If serum containing polyclonal antibodies is used, the polyclonal antibodies can be purified by immunoaffinity chromatography, using known procedures.

Monoclonal antibodies to the proteins of the present invention, and to the fragments thereof, can also be readily produced by one skilled in the art. The general methodology for making monoclonal antibodies by hybridomas is well known. Immortal antibody-producing cell lines can be created by cell fusion, and also by other techniques such as direct transformation of B lymphocytes with oncogenic DNA, or transfection with Epstein-Barr virus. See, e.g., M. Schreier et al., Hybridoma Techniques (1980); Hammerling et al., Monoclonal Antibodies and T-cell Hybridomas (1981); Kennett et al., Monoclonal Antibodies (1980); see also U.S. Pat. Nos. 4,341,761; 4,399,121; 4,427,783; 4,444,887; 4,452,570; 4,466,917; 4,472,500, 4,491,632; and 4,493,890. Panels of monoclonal antibodies produced against the antigen of interest, or fragment thereof, can be screened for various properties; i.e., for isotype, epitope, affinity, etc. Monoclonal antibodies are useful in purification, using immunoaffinity techniques, of the individual antigens which they are directed against.

Animals can be immunized with the compositions of the present invention by administration of the chimeric protein, or a fragment thereof, or an analog thereof. The chimeric protein can consist of an epitope of leukotcxin fused to an active fragment of a cytokine, as defined above. Thus, if the fragment or analog of the fusion protein is used, it will include the amino acid sequence of an epitope of leukotoxin which interacts with the immune system to immunize the animal to that and structurally similar epitopes, and an active fragment of a cytokine as defined above.

Chimeric proteins used to immunize a subject contain at least 6-30 amino acids which form the sequence of the desired chimeric protein, and include a leukotoxin epitope and an active cytokine fragment.

Prior to immunization, it may be desirable to increase the immunogenicity of the particular chimeric protein, or an analog of the protein, or particularly fragments of the protein. This can be accomplished in any one of several ways known to those of skill in the art. For example, the antigenic peptide may be administered linked to a carrier. For example, a fragment may be conjugated with a macromolecular carrier. Suitable carriers are typically large, slowly metabolized macromolecules such as: proteins; polysaccharides, such as sepharose, agarose, cellulose, cellulose beads and the like; polymeric amino acids such as polyglutamic acid, polylysine, and the like; amino acid copolymers; and inactive virus particles. Especially useful protein substrates are serum albumins, keyhole limpet hemocyanin, immunoglobulin molecules, thyroglobulin, ovalbumin, and other proteins well known to those skilled in the art.

The protein substrates may be used in their native form or their functional group content may be modified by, for example, succinylation of lysine residues or reaction with Cys-thiolactone. A sulfhydryl group may also be incorporated into the carrier (or antigen) by, for example, reaction of amino functions with 2-iminothiolane or the N-hydroxysuccinimide ester of 3-(4-dithiopyridyl propionate. Suitable carriers may also be modified to incorporate spacer arms (such as hexamethylene diamine or other bifunctional molecules of similar size) for attachment of peptides.

Other suitable carriers for the chimeric proteins of the present invention include VP6 polypeptides of rotaviruses, or functional fragments thereof, as disclosed in issued U.S. Pat. No. 5,071,651 and incorporated herein by reference. Also useful is a fusion product of a viral protein and the subject cytokine-leukotoxin immunogen made by methods disclosed in U.S. Pat. No. 4,722,840. Still other suitable carriers include cells, such as lymphocytes, since presentation in this form mimics the natural mode of presentation in the subject, which gives rise to the immunized state. Alternatively, the fusion proteins of the present invention may be coupled to erythrocytes, preferably the subject's own erythrocytes. Methods of coupling peptides to proteins or cells are known to those of skill in the art.

The novel chimeric proteins of the instant invention can also be administered via a carrier virus which expresses the same. Carrier viruses which will find use with the instant invention include but are not limited to the vaccinia and other pox viruses, adenovirus, and herpes virus. By way of example, vaccinia virus recombinants expressing the novel chimeric proteins can be constructed as follows. The DNA encoding the particular cytokine-leukotoxin chimeric protein is first inserted into an appropriate vector so that it is adjacent to a vaccinia promoter and flanking vaccinia DNA sequences, such as the sequence encoding thymidine kinase (TK). This vector is then used to transfect cells which are simultaneously infected with vaccinia. Homologous recombination serves to insert the vaccinia promoter plus the gene encoding the instant chimeric protein into the viral genome. The resulting TK.sup.- recombinant can be selected by culturing the cells in the presence of 5-bromodeoxyuridine and picking viral plaques resistant thereto.

It is also possible to immunize a subject with a protein of the present invention, or a protective fragment thereof, or an analog thereof, which is administered alone, or mixed with a pharmaceutically acceptable vehicle or excipient. Typically, vaccines are prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid vehicles prior to injection may also be prepared. The preparation may also be emulsified or the active ingredient encapsulated in liposome vehicles. The active immunogenic ingredient is often mixed with vehicles containing excipients which are pharmaceutically acceptable and compatible with the active ingredient. Suitable vehicles are, for example, water, saline, dextrose, glycerol, ethanol, or the like, and combinations thereof. In addition, if desired, the vehicle may contain minor amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents, or adjuvants which enhance the effectiveness of the vaccine. Adjuvants may include for example, muramyl dipeptides, avridine, aluminum hydroxide, oils, saponins and other substances known in the art. Actual methods of preparing such dosage forms are known, or will be apparent, to those skilled in the art. See. e.g., Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, Pennsylvania, 15th edition, 1975. The composition or formulation to be administered will, in any event, contain a quantity of the protein adequate to achieve the desired immunized state in the individual being treated.

Additional vaccine formulations which are suitable for other modes of administration include suppositories and, in some cases, aerosol, intranasal, oral formulations, and sustained release formulations. For suppositories, the vehicle composition will include traditional binders and carriers, such as, polyalkaline glycols, or triglycerides. Such suppositories may be formed from mixtures containing the active ingredient in the range of about 0.5% to about 10% (w/w), preferably about 1% to about 2%. Oral vehicles include such normally employed excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium, stearate, sodium saccharin cellulose, magnesium carbonate, and the like. These oral vaccine compositions may be taken in the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations, or powders, and contain from about 10% to about 95% of the active ingredient, preferably about 25% to about 70%.

Intranasal formulations will usually include vehicles that neither cause irritation to the nasal mucosa nor significantly disturb ciliary function. Diluents such as water, aqueous saline or other known substances can be employed with the subject invention. The nasal formulations may also contain preservatives such as, but not limited to, chlorobutanol and benzalkonium chloride. A surfactant may be present to enhance absorption of the subject proteins by the nasal mucosa.

Controlled or sustained release formulations are made by incorporating the chimeric protein into carriers or vehicles such as liposomes, nonresorbable impermeable polymers such as ethylenevinyl acetate copolymers and Hytrel.RTM. copolymers, swellable polymers such as hydrogels, or resorbable polymers such as collagen and certain polyacids or polyesters such as those used to make resorbable sutures. The chimeric proteins can also be delivered using implanted minipumps, well known in the art.

Furthermore, the chimeric proteins (or complexes thereof) may be formulated into vaccine compositions in either neutral or salt forms. Pharmaceutically acceptable salts include the acid addition salts (formed with the free amino groups of the active polypeptides) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed from free carboxyl groups may also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, 2-ethylamino ethanol, histidine, procaine, and the like.

To immunize a subject, the polypeptide of interest, or an immunologically active fragment thereof, is administered parenterally, usually by intramuscular injection in an appropriate vehicle. Other modes of administration, however, such as subcutaneous, intravenous injection and intranasal delivery, are also acceptable. Injectable vaccine formulations will contain an effective amount of the active ingredient in a vehicle, the exact amount being readily determined by one skilled in the art. The active ingredient may typically range from about 1% to about 95% (w/w) of the composition, or even higher or lower if appropriate. The quantity to be administered depends on the animal to be treated, the capacity of the animal's immune system to synthesize antibodies, and the degree of protection desired. With the present vaccine formulations, 50 ug of active ingredient per ml of injected solution should be adequate to raise an immunological response when a dose of 1 to 5 ml per animal is administered. Other effective dosages can be readily established by one of ordinary skill in the art through routine trials establishing dose response curves. The subject is immunized by lo administration of the particular antigen or fragment thereof, or analog thereof, in at least one dose, and preferably two doses. Moreover, the animal may be administered as many doses as is required to maintain a state of immunity to pneumonia.

Below are examples of specific embodiments for carrying out the present invention. The examples are offered for illustrative purposes only, and are not intended to limit the scope of the present invention in any way.

Deposits of Strains Useful in Practicing the Invention

A deposit of biologically pure cultures of the following strains was made with the American Type Culture Collection, 1230 1 Parklawn Drive, Rockville, Maryland. The accession number indicated was assigned after successful viability testing, and the requisite fees were paid. Access to said cultures will be available during pendency of the patent application to one determined by the Commissioner to be entitled thereto under 37 CFR 1.14 and 35 USC 122. All restriction on availability of said cultures to the public will be irrevocably removed upon the granting of a patent based upon the application. Moreover, the designated deposits will be maintained for a period of thirty (30) years from the date of deposit, or for five (5) years after the last request for the deposit; or for the enforceable life of the U.S. patent, whichever is longer. Should a culture become nonviable or be inadvertently destroyed, or, in the case of plasmid-containing strains, lose its plasmid, it will be replaced with a viable culture(s) of the same taxonomic description.

______________________________________ Strain Deposit Date ATCC No. ______________________________________ P. haemolytica serotype 1 B122 February 1, 1989 53863 pAA356 in E. coli W1485 August 14, 1990 68386 pAA352 in E. coli W1485 March 30, 1990 68283 ______________________________________

C. EXPERIMENTAL

Materials and Methods

Enzymes were purchased from commercial sources, and used according to the manufacturers' directions. Radionucleotides and nitrocellulose filters were also purchased from commercial sources.

In the cloning of DNA fragments, except where noted, all DNA manipulations were done according to standard procedures. See Sambrook et al., supra. Restriction enzymes, T.sup.4 DNA ligase, E. coli, DNA polymerase I, Klenow fragment, and other biological reagents were purchased from commercial suppliers and used according to the manufacturers' directions. Double-stranded DNA fragments were separated on agarose gels.

cDNA and genomic libraries were prepared by standard techniques in pUC13 and the bacteriophage lambda gt11, respectively. See DNA CLONING: Vols I and II, supra.

P. haemolytica biotype A, serotype 1 ("A1") strain B122 was isolated from the lung of a calf which died of pneumonic pasteurellosis and was stored at -70.degree. C. in defibrinated blood. Routine propagation was carried out on blood agar plates or in brain heart infusion broth (Difco Laboratories, Detroit, MI) supplemented with 5% (v/v) horse serum (Gibco Canada Ltd., Burlington, Canada). All cultures were incubated at 37.degree. C.

EXAMPLE 1

Construction of an IL2-leukotoxin Gene Fusion

1. Modification of the Bovine IL2 Gene

The bovine IL2 gene, in the plasmid pBOVIL2 (CIBA-GEIGY, Basel, Switzerland), was digested to completion with the restriction endonuclease BclI and the single-stranded ends removed by Mung Bean nuclease treatment. The DNA was then digested with EcoRI in order to excise the IL2 gene fragment. This fragment was ligated into the cloning vector pTZ19R (Pharmacia, Canada) (EcoRI/SmaI-digested). Sequence analysis revealed two populations of clones which differed only in the reading frame at the 3'-end of the) gene. The first, pAA284, had a terminal sequence of 5'-TCA ACA ATG ACT GGG ATC CTC-3' (SEQ ID NO.1) (BamHI site in vector underlined) while the second, pAA285, had a terminal sequence of 5'-TCA ACA ATG ACT GGG GAT CCT-3'(SEQ ID NO. 2). The sequences shown in bold face are from the IL2 gene. Because of the differences in reading frame, heterologous genes in two out of three reading frames can be fused to the bovine IL2 gene.

2. Construction of IL2-LKT Fusions

To isolate the leukotoxin gene, gene libraries of P. haemolytica A1 (strain B122) were constructed using standard techniques. See Lo et al., Infect. Immun., supra; DNA CLONING: Vols. I and II, supra; and T. MANIATIS et al., supra. A genomic library was constructed in the plasmid vector pUC13 and a DNA library constructed in the bacteriophage lambda gt11. The resulting clones were used to transform E. coli and individual colonies were pooled and screened for reaction with serum from a calf which had survived a P. haemolytica infection and that had been boosted with a concentrated culture supernatant of P. haemolytica to increase anti-leukotoxin antibody levels. Positive colonies were screened for their ability to produce leukotoxin by incubating cell lysates with bovine neutrophils and subsequently measuring release of lactate dehydrogenase from the latter.

Several positive colonies were identified and these recombinants were analyzed by restriction endonuclease mapping. One clone appeared to be identical to a leukotoxin gene cloned previously. See Lo et al., Infect. Immun., supra. To confirm this, smaller fragments were recloned and the restriction maps compared. It was determined that approximately 4 kilobase pairs of DNA had been cloned. Progressively larger clones were isolated by carrying out a chromosome walk (5' to 3' direction) in order to isolate full-length recombinants which were approximately 8 kb in length. The final construct was termed pAA114. This construct contained the entire leukotoxin gene sequence. The structure of this plasmid is shown in FIG. 1.

1ktA, a MaeI restriction endonuclease fragment from pAA114 which contained the entire leukotoxin gene, was treated with the Klenow fragment of DNA polymerase I plus nucleotide triphosphates and ligated into the SmaI site of the cloning vector pUC13. This plasmid was named pAA179. From this, an expression construct was made in the ptac-based vector pGH432: lac1 digested with SmaI. This construct was termed pAA345 and contained the entire MaeI fragment described above. This plasmid expresses full-length leukotoxin.

The plasmid pAA345 containing the P. haemolytica leukotoxin gene lktA was digested with BamHI and BglII, and the 2.75 kilobase fragment was ligated into BamHI-digested pAA285 (above). The resulting plasmid, pAA354, was digested with ApaLI, the 5'-overhang filled in with the Klenow fragment of DNA polymerase I, and finally digested with BamHI. The IL2-LKT fragment was gel purified and ligated into the expression vector pGH433 lacI which had been cut with BglII, filled in with Klenow polymerase and digested with BamHI. The resulting clone, pAA356 (ATCC No. 68386), contained the desired gene fusion under the control of the E. coli tac promoter. FIG. 2 shows the structure of pAA356 while FIG. 3 shows the nucleotide sequence and corresponding amino acid sequence of the fusion protein expressed by this plasmid. The resultinq fusion is a gene fusion of bovine IL2 to the 5' -end of the lktA gene (approximately 750 bp).

3. Purification of Recombinant IL2-LKT

Recombinant IL2-LKT was purified using the following procedure. Five to ten colonies of E. coli W1485/pAA356 (ATCC no. 68386) were inoculated into 10 ml of TB broth supplemented with 100 micrograms/ml of ampicillin and incubated at 37.degree. C. for 6 hours on a G10 shaker, 220 rpm. Four ml of this culture was diluted into each of two baffled Fernbach flasks containing 400 ml of TB broth+ampicillin and incubated overnight as described above. Cells were harvested by centrifugation for 10 minutes at 4,000 rpm in polypropylene bottles, 500 ml volume, using a Sorvall GS3 rotor. The pellet was resuspended in an equal volume of TB broth containing ampicillin which had been prewarmed to 37.degree. C. (i.e., 2.times.400 ml), and the cells were incubated for 2 hours as described above.

3.2 ml of isopropyl-B,D-thiogalactopyranoside (IPTG, Gibco/BRL), 500 mM in water (final concentration=4 mM), was added to each culture in order to induce synthesis of recombinant IL2-LKT. Cultures were incubated for two hours. Cells were harvested by centrifugation as described above, resuspended in 30 ml of 50 mM Tris-hydrochloride, 25% (w/v) sucrose, pH 8.0, and frozen at -70.degree. C. The frozen cells were thawed at room temperature after 60 minutes at -70.degree. C., and 5 ml of lysozyme (Sigma, 20 mg/ml in 250 mM Tris-HCl, pH 8.0) was added. The mixture was vortexed at high speed for 10 seconds and then placed on ice for 15 minutes. The cells were then added to 500 ml of lysis buffer in a 1000 ml beaker and mixed by stirring with a 2 ml pipette. The beaker containing the lysed cell suspension was placed on ice and sonicated for a total of 2.5 minutes (5-30 second bursts with 1 minute cooling between each) with a Braun sonicator, large probe, set at 100 watts power. Equal volumes of the solution were placed in Teflon SS34 centrifuge tubes and centrifuged for 20 minutes at 10,000 rpm in a Sorvall SS34 rotor. The pellets were resuspended in a total of 100 ml of sterile double distilled water by vortexing at high speed, and the centrifugation step repeated. Supernatants were discarded and the pellets combined in 20 ml of 10 mM Tris-HCl, 150 mM NaCl, pH 8.0 (Tris-buffered saline) and the suspension frozen overnight at -20.degree. C.

The recombinant suspension was thawed at room temperature and added to 100 ml of 8 M Guanidine HCl (Sigma) in Tris-buffered saline and mixed vigorously. A magnetic stir bar was placed in the bottle and the solubilized sample was mixed at room temperature for 30 minutes. The solution was transferred to a 2000 ml Ehrlenmyer flask and 1200 ml of Tris-buffered saline was quickly added. This mixture was stirred at room temperature for an additional 2 hours. 500 ml aliquots were placed in dialysis bags (Spectrum, 63.7 mm diameter, 6,000-8,000 MW cutoff, #132670, from Fisher scientific) and these were placed in 4,000 ml beakers containing 3,500 ml cf Tris-buffered saline +0.5 M Guanidine HCl. The beakers were placed in a 4.degree. C. room on a magnetic stirrer overnight after which dialysis buffer was replaced with Tris-buffered saline +0.1 M Guanidine HCl and dialysis continued for 12 hours. The buffer was then replaced with Tris-buffered saline +0.05 M Guanidine HCl and dialysis continued overnight. The buffer was replaced with Tris-buffered saline (no guanidine), and dialysis continued for 12 hours. This was repeated three more times. The final solution was poured into a 2000 ml plastic roller bottle (Corning) and 13 ml of 100 mM PMSF (in ethanol) was added to inhibit protease activity. The solution was stored at -20.degree. C. in 100 ml aliquots.

EXAMPLE 2

Measurement of IL2 Activity

Cell-free lysates were prepared by detergent lysis from E. coli carrying pAA356 as described above and an isogenic strain carrying the pGH433 vector without IL2-LKT. The IL2-LKT molecule was evident on polyacrylamide gel electrophoresis. IL2 activity was measured using an IL2-dependent T-cell line derived from Con-A-stimulated peripheral blood mononuclear cells. The recombinant lysates were added to IL2-dependent cells and proliferation was measured after 48 hours incubation at 37.degree. C. The proliferative response to IL2 was compared to T lymphocytes cultured in medium alone or cells stimulated with recombinant human IL2 (specific activity =3.6.times.10.sup.6 U/mg). Recombinant leukotoxin without IL2 was also included as a control. The results, shown in Table 1, confirm the IL2 activity of the fusion protein.

TABLE 1 ______________________________________ IL2 Activity of IL2-LKT Fusion Product Tested on an IL2-Dependent T-Cell Line.sup.a Counts per Minute Sample 10.sup.-2 20.sup.-3 10.sup.-4 ______________________________________ Recombinant Leukotoxin 357 372 383 Vector Only (pGH433) 487 598 506 IL2-LKT (pAA356) 28,634 22,329 9,961 ______________________________________ .sup.a Activity induced by recombinant human IL2 standards: 25 U/ml = 30,159 cpm; 12 U/ml = 23,666 cpm; 6 U/ml = 22,837 cpm; 3 U/ml = 15,828 cpm; 1.5 U/ml = 8.944 cpm; 0.6 U/ml = 3,233 cpm.

Thus, it is evident that the chimeric protein retains IL2 cell proliferative activity.

EXAMPLE 3

Serological Response to P. haemolytica LKT and the IL2-LKT Chimeric Molecule

To test whether the serological activity of the chimeric molecule differed from the serological activity of leukotoxin alone, the following experiment was done.

Calves (three per group) were immunized at time 0 with 100 .mu.g of: (1) full-length recombinant P. haemolytica leukotoxin (LKT), (2) an equivalent molar ratio of the IL2-LKT chimeric protein, or (3) PBS. All of these were formulated in phosphate-buffered saline with Emulsigen as the adjuvant. Serological assessment of immune responsiveness to LKT or the chimera was carried out at -15, -7, -3 days and immediately prior to immunization on day 0, and daily for 20 days post-immunization. Serum antibody of the IgG class was assessed by enzyme-linked immunosorbent assay, using leukotoxin as the antigen.

As can be seen in FIGS. 4A-4C, the mean of individual serological titers in the nonimmunized group (FIG. 4A) remained at levels below 1/32 (log.sub.2 5). One of the three calves in this group seroconverted to leukotoxin positive at day 20 because of natural infection with P. haemolytica. In the LKT-immunized group (4B), titers began to rise at day 6 after immunization, reaching a maximum (1/1024-1/8192; log.sub.2 10-14) on day 8-10, where they remained for the duration of the experiment. In the chimera-immunized animals (4C), responses to LKT began to rise after day 4 postimmunization, reaching a maximum (1/1024-1/4096 log.sub.2 10-12) on day 8 after immunization.

Thus, the serological activity of the chimeric molecule when compared to the activity of leukotoxin alone was not significantly different, both with respect to kinetics and magnitude. Serum antibody from one animal in the leukotoxin immunized group appeared to react with leukotoxin prior to immunization (with titers >1/128; log.sub.2 7), and while it is unlikely that this animal suffered a P. haemolytica infection, serum antibodies against another bacterial toxin could be cross-reacting with leukotoxin. The conclusion from this experiment is that when IL2 is genetically chimerized to the leukotoxin molecule, it does not affect the ability of the LKT to induce a normal IgG antibody response when compared to the administration of recombinant leukotoxin alone.

EXAMPLE 4

Immunization of Calves with LKT and the IL2-LKT Chimeric Molecule

Calves were immunized at time 0 according to the protocols in Table 2. 117 micrograms of IL2-LKT were given (molar equivalent) and 100 micrograms of LKT given (molar equivalent).

TABLE 2 ______________________________________ Calf Immunization Protocols Number Antigen Adjuvant of Doses Interval ______________________________________ LKT Emulsigen-plus 5 12 H IL2-LKT Emulsigen-plus 5 12 H IL2-LKT Emulsigen-plus 1 IL2-LKT None 5 12 H ______________________________________ LKT refers to fulllength leukotoxin. IL2-LKT refers to LKT chimerized to bovine IL2. In multipledose regimes, five doses were given at 12 h intervals over 2.5 days.

1. Precursor Frequency Analysis

The number of cells capable of responding to LKT following immunization was assessed using limiting dilution analysis (LDA). At the times indicated following immunization, T and B lymphocytes were isolated from peripheral blood by passing through Sephadex G-10 columns. Monocyte depletion was confirmed by flow cytometry. This cell population was diluted to various concentrations (10.sup.5 to 10.sup.2 /ml) and added to 96-well plates in the presence of feeder cells (autologous 1500 rad irradiated PBMC) and antigen (LKT) at a previously determined optimal concentration (20 .mu.g/ml). In some experiments, cells were stimulated with IL2-LKT (LKT356) or an equimolar concentration of IL2. Following incubation at 37.degree. C. for 5 to 7 days, .sup.3 H-thymidine was added to wells and cultures were harvested after an additional 24 hours incubation, counted and the percent negative cultures assessed following comparison with control cultures (i.e., cells cultured in the absence of antigen) Semi-Log.sub.10 plots were done of Log.sub.10 Percent negative cultures (Y) against number of cells plated (X). The number of cells responding at 37% negative cultures was calculated from an equation derived from the regression curve of Y versus X.

As can be seen in FIG. 5, the chimerization of LKT to IL2 does not affect the ability of PBMC to respond to the IL2 component of the molecule. Furthermore, precursor frequency analysis of cells responding to LKT or IL2-LKT yielded the following results: After immunization with LKT or IL2-LKT, with or without the adjuvant Emulsigen-plus, there was a dramatic increase in the number of cells responding to LKT. Following a single immunizing dose of IL2-LKT with Emulsigen-plus, there was no detectable increase in precursor frequency (Table 3).

2. Serology

Serum from the immunized calves was assessed for antibodies against LKT at the times indicated in Table 3. LKT antibodies were detected using standard ELISAs.

All animals showed an increased antibody titer against LKT following immunization. Increases were more marked in those animals given Emulsigen-plus in the formulation. Specifically, animals immunized with the chimera had a titer of 1/700 15 days after immunization, whereas when the same immunization was done with Emulsigen-plus, the titer was 1/35,000. Furthermore, even following one dose of IL2-LKT with Emulsigen-plus, the serological titer was 1/2500 (Table 3).

TABLE 3 ______________________________________ Time Immunization.sup.a Adjuvant.sup.b (D).sup.c F.sup.d Serology.sup.e ______________________________________ LKT (M) Emulsigen-plus 0 1:55657 1/150 15 1:11087 1/6000 IL2-LKT (M) None 0 1:16728 1/200 15 1:8976 1/700 IL2-LKT (S) Emulsigen-plus 0 1:50755 1/300 15 1:117317 1/2500 IL2-LKT (M) None*** 0 1:20728 1/1000 15 1:16882 1/35000 ______________________________________ .sup.a M: multiple dose regimen; S: single bolus dose. .sup.b Adjuvant given with all doses. ***High values at time 0 may indicate a prior infection or xreactivity. .sup.c Time following first inoculation. .sup.d Precursor frequency of B and T cells proliferating in response to LKT. .sup.e Serology determined by ELISA using LKT as antigen.

Thus, this study demonstrated the ability of LKT and IL2-LKT formulations to elicit cellular and humoral immunity responses following single or multiple immunization. When Emulsigen-plus was used as an adjuvant, there was a high serological response. This was regardless of whether LKT or IL2-LKT was given as a single or multiple immunization regimen. The single dose inoculum gave a high humoral response (antibody titer) in the near absence of any detectable cellular response. The animal that elicited the highest cellular response after immunization was that which was given IL2-LKT alone. Therefore, IL2-LKT can elicit the highest state of cellular reactivity. A higher humoral response can also be elicited by combining the chimeric protein with an adjuvant.

EXAMPLE 5

Construction of a .gamma.IFN-Leukotoxin Gene Fusion

To isolate the leukotoxin gene, gene libraries of P. haemolytica A1 (strain B122) were constructed using standard techniques. See Lo et al., Infect. Immun., supra; DNA CLONING: Vols. I and II, supra; and T. MANIATIS et al., supra. A genomic library was constructed in the plasmid vector pUC13 and a DNA library constructed in the bacteriophage lambda gt11. The resulting clones were used to transform E. coli and individual colonies were pooled and screened for reaction with serum from a calf which had survived a P. haemolytica infection and that had been boosted with a concentrated culture supernatant of P. haemolytica to increase anti-leukotoxin antibody levels. Positive colonies were screened for their ability to produce leukotoxin by incubating cell lysates with bovine neutrophils and subsequently measuring release of lactate dehydrogenase from the latter.

Several positive colonies were identified and these recombinants were analyzed by restriction endonuclease mapping. One clone appeared to be identical to a leukotoxin gene cloned previously. See Lo et al., Infect. Immun., supra. To confirm this, smaller fragments were recloned and the restriction maps compared. It was determined that approximately 4 kilobase pairs of DNA had been cloned. Progressively larger clones were isolated by carrying out a chromosome walk (5' to 3' direction) in order to isolate full-length recombinants which were approximately 8 kb in length. The final construct was termed pAA114. This construct contained the entire leukotoxin gene sequence. The structure of this plasmid is shown in FIG. 1.

1ktA, a MaeI restriction endonuclease fragment from pAA114 which contained the entire leukotoxin gene, was treated with the Klenow fragment of DNA polymerase I plus nucleotide triphosphates and ligated into the SmaI site of the cloning vector pUC13. This plasmid was named pAA179. From this, two expression constructs were made in the ptac-based vector pGH432: lacI digested with SmaI. One, pAA342, consisted of the 5' -AhaIII fragment of the 1ktA gene while the other, pAA345, contained the entire MaeI fragment described above. The clone pAA342 expressed a truncated leukotoxin peptide at high levels while pAA345 expressed full length leukotoxin at very low levels. Therefore, the 3' end of the lktA gene (StyI BamHI fragment from pAA345) was ligated to StyI BamHI-digested pAA342, yielding the plasmid pAA352.

The coding sequence of the bovine .gamma.IFN gene from the plasmid pBOVIFN.gamma. (CIBA-GEIGY, Basel, Switzerland), was cloned as a BalI/SspI fragment into pAA352 digested with BamHI and filled in with Klenow DNA Polymerase. The ligation mixture was transformed into E. coli strain JM105 and ampicillin-resistant transformants were selected. DNA from four transformants was analyzed by restriction endonuclease digestion and one plasmid, pAA497 (FIG. 6), was found to contain the interferon gene in the correct orientation. The nucleotide sequence and corresponding amino acid sequence of the fusion is shown in FIG. 7.

The recombinant fusion protein was purified as described in Example 1.3.

EXAMPLE 6

Measurement of .gamma.IFN Activity

Purified recombinant .gamma.IFN-LKT was prepared as described above. IFN activity was tested using three different assays:

1) Expression of MHC class II on monocytes and macrophages.

2) Inhibition of T cell proliferation.

3) Ability to inhibit viral replication.

1. Expression of MHC Class II on Monocytes and Macrophages

Peripheral blood mononuclear cells (PBMC) were isolated from bovine venous blood and incubated at 37.degree. C. for 18 hours with different concentrations of the .gamma.IFN-LKT chimera and molar equivalent amounts of recombinant bovine .gamma.IFN. Cells were then washed and resuspended in PBS-gelatin containing NaN.sub.3. Cells were incubated with mouse monoclonal anti-MHC Class II antibody for 30 minutes followed by 30 minutes incubation with FITC labelled goat anti-mouse antibody. The percent positive and peak fluorescence was estimated using a Becton-Dickenson FACScan. Results are shown in Table 4. An elevation of peak fluorescence is an indication of interferon activity.

TABLE 4 ______________________________________ Peak Fluorescence Source Cells Medium .gamma.IFN .gamma.IFN-LKT ______________________________________ Animal #1 114 153 140 Animal #2 120 139 140 ______________________________________

2. Inhibition of T-Cell Proliferation

Cells were incubated with Con-A in the presence of LKT, .gamma.IFN-LKT, or LKT +.gamma.IFN, and the proliferative response assessed following three days of incubation. Results are shown in Table 5. A decrease in this response is indicative of IFN activity.

TABLE 5 ______________________________________ Increased Proliferative Response Source Cells Medium .gamma.IFN-LKT LKT + .gamma.IFN ______________________________________ Animal #1 ++++ +/- ++ Animal #2 ++++ - ++ ______________________________________

3. Ability to Inhibit Viral Replication

The activity of .gamma.IFN-LKT was directly compared to the activity of equimolar quantities of .gamma.IFN in a standard VSV plaque inhibition assay using GBK cells as previously reported (Babiuk, L.A. and Rouse, B.T. (1976) Infect. lmmun. 13:1567). Briefly, GBK cells growing in 96-well flat-bottom tissue culture plates (NUNC, Roskilde, DK) were treated with two-fold dilutions of recombinant .gamma.IFN. After overnight incubation, the culture media was removed and 100 .mu.l of fresh culture media containing 100 PFU of VSV was added to each well. After 2 hr of incubation, this virus inoculum was removed and the wells were overlayed with 200 .mu.l of methyl cellulose/MEM. Culture plates were further incubated for 2 hr and stained with crystal violet. The antiviral titer was taken as the dilution of supernatants at which 50% of the cells were protected against VSV. The specific activity of the chimera was estimated as 78,000 units per mg protein.

EXAMPLE 7

Identification of Neutralizing Epitopes of Leukotoxin

The P. haemolytica leukotoxin protein contains a series of repeated amino acid domains near the carboxy terminus. These domains are likely to be epitopes useful in the subject chimeric proteins. The consensus amino acid sequence is Gly-Gly-X-Gly-X-Asp (SEQ ID NO. 3), where X is Lys, Asp, Val or Asn. (Highlander et al. (1989) DNA 8:15-28.) However, other substitutions likely to render immunologically active peptides include substitutions with an aliphatic amino acid, such as Gly, Ala, Val, Leu, Ile, a charged amino acid such as Asp, Glu, Arg, His or Lys, or a corresponding neutral amino acid such as Asn or Gln.

Based on this information, a synthetic peptide of the sequence GGNGDDFIDGGKGNDLLHGG (SEQ ID NO. 4) was constructed by standard solid phase technology on an Applied Biosystems peptide synthesizer. Mice were immunized with authentic leukotoxins prepared from either P. haemolytica, or Actinobacillus pleuropneumoniae (serotypes 1 and 5) at 100 micrograms per dose with Freund's Complete Adjuvant (first vaccination) or Freund's Incomplete Adjuvant (all subsequent vaccinations). High titer serum samples from immunized mice were tested, in a standard ELISA, for the following: (1) their ability to react with recombinant and authentic P. haemolytica leukotoxin; (2) their ability to react with the toxin produced by A. pleuropneumoniae; and (3) their ability to react with the synthetic peptide described above. The results, summarized in Table 6, are expressed as the relative reactivity at a serum dilution of 1 in 100,000.

TABLE 6 ______________________________________ Presence of Synthetic Peptide Epitopes in Toxins from P. haemolytica and A. pleuropneumonia serotypes 1 and 5 Relative Serological Response To: Synthetic Actinobacillus Pasteurella Toxin Prepared From: Peptide Toxin Toxin ______________________________________ A. pleuropneumoniae +++ ++++ ++ sero. 5 A. pleuropneumoniae + ++++ + sero. 1 P. haemolytica +++ not determined ++++ ______________________________________

This data indicated that animals vaccinated with either of the three leukotoxins developed antibodies which reacted with all toxins and a synthetic peptide based on a portion of the P. haemolytica toxin. Once an appropriate level of anti-peptide serum antibody was reached (ELISA titer of 100,000 or greater), spleen cells were fused with NS1 cells and monoclonal antibody-producing clones were isolated by standard techniques. Culture supernatants from these clones were tested for their ability to react with the synthetic peptide (above) and the respective toxins in an ELISA assay. The results for 2 clones are shown in Table 7.

TABLE 7 ______________________________________ Relative Reaction With: Actino- Pasteurella Synthetic bacillus Clone Immunogen Toxin Peptide Toxin ______________________________________ ET122-6A4-3 Pasteurella ++++ +++++ ND.sup.1 toxin N37-3F9-6 Actino- ND ++++ +++++ bacillus toxin ______________________________________ .sup.1 Not determined

These results demonstrate that each of these monoclonal antibodies react with an epitope which is shared by the P. haemolytica and A. pleuropneumoniae toxins, and that this epitope is structurally similar to that of the synthetic peptide. This peptide is also structurally similar to a bovine rotavirus synthetic peptide of the sequence TMNGNEFQTGGIGNLPIRNWNAC (SEQ ID NO. 5), representing amino acids 40-60 of the VP6 protein. The monoclonal antibodies described above can therefore be used to determine the degree of their cross-reactivity with rotavirus proteins based on the epitope represented by the synthetic peptides. Furthermore, the immunologically active leukotoxin fragments might prove useful in immunizing against rotavirus.

These leukotoxin epitopes can be fused to cytokines such as IL2 and .gamma.IFN, or active fragments thereof, to form chimeric proteins for use in vaccine compositions.

Thus, chimeric proteins for use in stimulating immunity against pneumonia and other respiratory diseases have been disclosed. Although preferred embodiments of the subject invention have been described in some detail, it is understood that obvious variations can be made without departing from the spirit and the scope of the invention as defined by the appended claims.

__________________________________________________________________________ SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF SEQUENCES: 9 (2) INFORMATION FOR SEQ ID NO:1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: TCAACAATGACTGGGATCCT C21 (2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: TCAACAATGACTGGGGATCCT 21 (2) INFORMATION FOR SEQ ID NO:3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 6 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: GlyGlyXaaGlyXaaAsp 1 5 (2) INFORMATION FOR SEQ ID NO:4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: GlyGlyAsnGlyAspAspPheIleAspGlyGlyLysGlyAsnAsp Leu 1 51015 LeuHisGlyGly 20 (2) INFORMATION FOR SEQ ID NO:5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 23 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: ThrMetAsnGlyAsnGluPheGlnThrGlyGlyIleGlyAsnLeuPro 151015 IleArgAsnTrpAsnAlaCys 20 (2) INFORMATION FOR SEQ ID NO:6: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 3311 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..3294 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: ATGGCTACTGTTAATAGATCTGCACCTA CTTCAAGCTCTACGGGGAAC48 MetAlaThrValAsnArgSerAlaProThrSerSerSerThrGlyAsn 151015 ACAATGAAAGAAGTGAAGTCATTGCTG CTGGATTTACAGTTGCTTTTG96 ThrMetLysGluValLysSerLeuLeuLeuAspLeuGlnLeuLeuLeu 202530 GAGAAAGTTAAAAATCCTGAGAACCTCAAG CTCTCCAGGATGCATACA144 GluLysValLysAsnProGluAsnLeuLysLeuSerArgMetHisThr 354045 TTTGACTTTTACGTGCCCAAGGTTAACGCTACAGA ATTGAAACATCTT192 PheAspPheTyrValProLysValAsnAlaThrGluLeuLysHisLeu 505560 AAGTGTTTACTAGAAGAACTCAAACTTCTAGAGGAAGTGCTAA ATTTA240 LysCysLeuLeuGluGluLeuLysLeuLeuGluGluValLeuAsnLeu 65707580 GCTCCAAGCAAAAACCTGAACCCCAGAGAGATCAAGGAT TCAATGGAC288 AlaProSerLysAsnLeuAsnProArgGluIleLysAspSerMetAsp 859095 AATATCAAGAGAATCGTTTTGGAACTACAGGGATCTGAA ACAAGATTC336 AsnIleLysArgIleValLeuGluLeuGlnGlySerGluThrArgPhe 100105110 ACATGTGAATATGATGATGCAACAGTAAACGCTGTAGAATT TCTGAAC384 ThrCysGluTyrAspAspAlaThrValAsnAlaValGluPheLeuAsn 115120125 AAATGGATTACCTTTTGTCAAAGCATCTACTCAACAATGACTGGGG AT432 LysTrpIleThrPheCysGlnSerIleTyrSerThrMetThrGlyAsp 130135140 CTAAGCTTCCCTAGACTTACAACCCTATCAAATGGGCTAAAAAACACT480 LeuSerPheProArgLeuThrThrLeuSerAsnGlyLeuLysAsnThr 145150155160 TTAACGGCAACCAAAAGTGGCTTACATAAAGCCGGTCAATCATTAACC 528 LeuThrAlaThrLysSerGlyLeuHisLysAlaGlyGlnSerLeuThr 165170175 CAAGCCGGCAGTTCTTTAAAAACTGGGGCAAAAAAAATTATCCTCTAT 576 GlnAlaGlySerSerLeuLysThrGlyAlaLysLysIleIleLeuTyr 180185190 ATTCCCCAAAATTACCAATATGATACTGAACAAGGTAATGGTTTACAG 624 IleProGlnAsnTyrGlnTyrAspThrGluGlnGlyAsnGlyLeuGln 195200205 GATTTAGTCAAAGCGGCCGAAGAGTTGGGGATTGAGGTACAAAGAGAA672 As pLeuValLysAlaAlaGluGluLeuGlyIleGluValGlnArgGlu 210215220 GAACGCAATAATATTGCAACAGCTCAAACCAGTTTAGGCACGATTCAA720 GluArgAsnA snIleAlaThrAlaGlnThrSerLeuGlyThrIleGln 225230235240 ACCGCTATTGGCTTAACTGAGCGTGGCATTGTGTTATCCGCTCCACAA768 ThrAla IleGlyLeuThrGluArgGlyIleValLeuSerAlaProGln 245250255 ATTGATAAATTGCTACAGAAAACTAAAGCAGGCCAAGCATTAGGTTCT816 IleAsp LysLeuLeuGlnLysThrLysAlaGlyGlnAlaLeuGlySer 260265270 GCCGAAAGCATTGTACAAAATGCAAATAAAGCCAAAACTGTATTATCT864 AlaGluSe rIleValGlnAsnAlaAsnLysAlaLysThrValLeuSer 275280285 GGCATTCAATCTATTTTAGGCTCAGTATTGGCTGGAATGGATTTAGAT912 GlyIleGlnSerI leLeuGlySerValLeuAlaGlyMetAspLeuAsp 290295300 GAGGCCTTACAGAATAACAGCAACCAACATGCTCTTGCTAAAGCTGGC960 GluAlaLeuGlnAsnAsnSer AsnGlnHisAlaLeuAlaLysAlaGly 305310315320 TTGGAGCTAACAAATTCATTAATTGAAAATATTGCTAATTCAGTAAAA1008 LeuGluLeuThrAsnSer LeuIleGluAsnIleAlaAsnSerValLys 325330335 ACACTTGACGAATTTGGTGAGCAAATTAGTCAATTTGGTTCAAAACTA1056 ThrLeuAspGluPheGl yGluGlnIleSerGlnPheGlySerLysLeu 340345350 CAAAATATCAAAGGCTTAGGGACTTTAGGAGACAAACTCAAAAATATC1104 GlnAsnIleLysGlyLeuG lyThrLeuGlyAspLysLeuLysAsnIle 355360365 GGTGGACTTGATAAAGCTGGCCTTGGTTTAGATGTTATCTCAGGGCTA1152 GlyGlyLeuAspLysAlaGlyLeu GlyLeuAspValIleSerGlyLeu 370375380 TTATCGGGCGCAACAGCTGCACTTGTACTTGCAGATAAAAATGCTTCA1200 LeuSerGlyAlaThrAlaAlaLeuValLeuAla AspLysAsnAlaSer 385390395400 ACAGCTAAAAAAGTGGGTGCGGGTTTTGAATTGGCAAACCAAGTTGTT1248 ThrAlaLysLysValGlyAlaGlyPheGl uLeuAlaAsnGlnValVal 405410415 GGTAATATTACCAAAGCCGTTTCTTCTTACATTTTAGCCCAACGTGTT1296 GlyAsnIleThrLysAlaValSerSerT yrIleLeuAlaGlnArgVal 420425430 GCAGCAGGTTTATCTTCAACTGGGCCTGTGGCTGCTTTAATTGCTTCT1344 AlaAlaGlyLeuSerSerThrGlyProVal AlaAlaLeuIleAlaSer 435440445 ACTGTTTCTCTTGCGATTAGCCCATTAGCATTTGCCGGTATTGCCGAT1392 ThrValSerLeuAlaIleSerProLeuAlaPheAla GlyIleAlaAsp 450455460 AAATTTAATCATGCAAAAAGTTTAGAGAGTTATGCCGAACGCTTTAAA1440 LysPheAsnHisAlaLysSerLeuGluSerTyrAlaGluArgPh eLys 465470475480 AAATTAGGCTATGACGGAGATAATTTATTAGCAGAATATCAGCGGGGA1488 LysLeuGlyTyrAspGlyAspAsnLeuLeuAlaGluTyrG lnArgGly 485490495 ACAGGGACTATTGATGCATCGGTTACTGCAATTAATACCGCATTGGCC1536 ThrGlyThrIleAspAlaSerValThrAlaIleAsnThr AlaLeuAla 500505510 GCTATTGCTGGTGGTGTGTCTGCTGCTGCAGCCGGCTCGGTTATTGCT1584 AlaIleAlaGlyGlyValSerAlaAlaAlaAlaGlySerVal IleAla 515520525 TCACCGATTGCCTTATTAGTATCTGGGATTACCGGTGTAATTTCTACG1632 SerProIleAlaLeuLeuValSerGlyIleThrGlyValIleSerTh r 530535540 ATTCTGCAATATTCTAAACAAGCAATGTTTGAGCACGTTGCAAATAAA1680 IleLeuGlnTyrSerLysGlnAlaMetPheGluHisValAlaAsnLys 545 550555560 ATTCATAACAAAATTGTAGAATGGGAAAAAAATAATCACGGTAAGAAC1728 IleHisAsnLysIleValGluTrpGluLysAsnAsnHisGlyLysAsn 565570575 TACTTTGAAAATGGTTACGATGCCCGTTATCTTGCGAATTTACAAGAT1776 TyrPheGluAsnGlyTyrAspAlaArgTyrLeuAlaAsnLeuGlnAsp 580585590 AATATGAAATTCTTACTGAACTTAAACAAAGAGTTACAGGCAGAACGT1824 AsnMetLysPheLeuLeuAsnLeuAsnLysGluLeuGlnAlaGluArg 595600605 GTCATCGCTATTACTCAGCAGCAATGGGATAACAACATTGGTGATTTA1872 ValIleAlaIleThrGlnGlnGlnTrpAspAsnAsnIleGlyAspLeu 610 615620 GCTGGTATTAGCCGTTTAGGTGAAAAAGTCCTTAGTGGTAAAGCCTAT1920 AlaGlyIleSerArgLeuGlyGluLysValLeuSerGlyLysAlaTyr 625630 635640 GTGGATGCGTTTGAAGAAGGCAAACACATTAAAGCCGATAAATTAGTA1968 ValAspAlaPheGluGluGlyLysHisIleLysAlaAspLysLeuVal 64 5650655 CAGTTGGATTCGGCAAACGGTATTATTGATGTGAGTAATTCGGGTAAA2016 GlnLeuAspSerAlaAsnGlyIleIleAspValSerAsnSerGlyLys 660 665670 GCGAAAACTCAGCATATCTTATTCAGAACGCCATTATTGACGCCGGGA2064 AlaLysThrGlnHisIleLeuPheArgThrProLeuLeuThrProGly 675 680685 ACAGAGCATCGTGAACGCGTACAAACAGGTAAATATGAATATATTACC2112 ThrGluHisArgGluArgValGlnThrGlyLysTyrGluTyrIleThr 690695 700 AAGCTCAATATTAACCGTGTAGATAGCTGGAAAATTACAGATGGTGCA2160 LysLeuAsnIleAsnArgValAspSerTrpLysIleThrAspGlyAla 705710 715720 GCAAGTTCTACCTTTGATTTAACTAACGTTGTTCAGCGTATTGGTATT2208 AlaSerSerThrPheAspLeuThrAsnValValGlnArgIleGlyIle 725 730735 GAATTAGACAATGCTGGAAATGTAACTAAAACCAAAGAAACAAAAATT2256 GluLeuAspAsnAlaGlyAsnValThrLysThrLysGluThrLysIle 740 745750 ATTGCCAAACTTGGTGAAGGTGATGACAACGTATTTGTTGGTTCTGGT2304 IleAlaLysLeuGlyGluGlyAspAspAsnValPheValGlySerGly 755760 765 ACGACGGAAATTGATGGCGGTGAAGGTTACGACCGAGTTCACTATAGC2352 ThrThrGluIleAspGlyGlyGluGlyTyrAspArgValHisTyrSer 770775 780 CGTGGAAACTATGGTGCTTTAACTATTGATGCAACCAAAGAGACCGAG2400 ArgGlyAsnTyrGlyAlaLeuThrIleAspAlaThrLysGluThrGlu 785790795 800 CAAGGTAGTTATACCGTAAATCGTTTCGTAGAAACCGGTAAAGCACTA2448 GlnGlySerTyrThrValAsnArgPheValGluThrGlyLysAlaLeu 805810 815 CACGAAGTGACTTCAACCCATACCGCATTAGTGGGCAACCGTGAAGAA2496 HisGluValThrSerThrHisThrAlaLeuValGlyAsnArgGluGlu 820825 830 AAAATAGAATATCGTCATAGCAATAACCAGCACCATGCCGGTTATTAC2544 LysIleGluTyrArgHisSerAsnAsnGlnHisHisAlaGlyTyrTyr 83584084 5 ACCAAAGATACCTTGAAAGCTGTTGAAGAAATTATCGGTACATCACAT2592 ThrLysAspThrLeuLysAlaValGluGluIleIleGlyThrSerHis 850855860 AACGAT ATCTTTAAAGGTAGTAAGTTCAATGATGCCTTTAACGGTGGT2640 AsnAspIlePheLysGlySerLysPheAsnAspAlaPheAsnGlyGly 865870875880 GA TGGTGTCGATACTATTGACGGTAACGACGGCAATGACCGCTTATTT2688 AspGlyValAspThrIleAspGlyAsnAspGlyAsnAspArgLeuPhe 885890895 G GTGGTAAAGGCGATGATATTCTCGATGGTGGAAATGGTGATGATTTT2736 GlyGlyLysGlyAspAspIleLeuAspGlyGlyAsnGlyAspAspPhe 900905910 ATC GATGGCGGTAAAGGCAACGACCTATTACACGGTGGCAAGGGCGAT2784 IleAspGlyGlyLysGlyAsnAspLeuLeuHisGlyGlyLysGlyAsp 915920925 GATATTTTC GTTCACCGTAAAGGCGATGGTAATGATATTATTACCGAT2832 AspIlePheValHisArgLysGlyAspGlyAsnAspIleIleThrAsp 930935940 TCTGACGGCAATGATAA ATTATCATTCTCTGATTCGAACTTAAAAGAT2880 SerAspGlyAsnAspLysLeuSerPheSerAspSerAsnLeuLysAsp 945950955960 TTAACATTTGAAA AAGTTAAACATAATCTTGTCATCACGAATAGCAAA2928 LeuThrPheGluLysValLysHisAsnLeuValIleThrAsnSerLys 965970975 AAAGAGAAAGTG ACCATTCAAAACTGGTTCCGAGAGGCTGATTTTGCT2976 LysGluLysValThrIleGlnAsnTrpPheArgGluAlaAspPheAla 980985990 AAAGAAGTGCCTAAT TATAAAGCAACTAAAGATGAGAAAATCGAAGAA3024 LysGluValProAsnTyrLysAlaThrLysAspGluLysIleGluGlu 99510001005

ATCATCGGTCAAAATGGCG AGCGGATCACCTCAAAGCAAGTTGATGAT3072 IleIleGlyGlnAsnGlyGluArgIleThrSerLysGlnValAspAsp 101010151020 CTTATCGCAAAAGGTAACGGCAAAATT ACCCAAGATGAGCTATCAAAA3120 LeuIleAlaLysGlyAsnGlyLysIleThrGlnAspGluLeuSerLys 1025103010351040 GTTGTTGATAACTATGAATTGC TCAAACATAGCAAAAATGTGACAAAC3168 ValValAspAsnTyrGluLeuLeuLysHisSerLysAsnValThrAsn 104510501055 AGCTTAGATAAGTTAATCTCA TCTGTAAGTGCATTTACCTCGTCTAAT3216 SerLeuAspLysLeuIleSerSerValSerAlaPheThrSerSerAsn 106010651070 GATTCGAGAAATGTATTAGTGG CTCCAACTTCAATGTTGGATCAAAGT3264 AspSerArgAsnValLeuValAlaProThrSerMetLeuAspGlnSer 107510801085 TTATCTTCTCTTCAATTTGCTAGGGGA TCCTAGCTAGCTAGCCATGG3311 LeuSerSerLeuGlnPheAlaArgGlySer 10901095 (2) INFORMATION FOR SEQ ID NO:7: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1098 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: MetAlaThrValAsnArgSerAlaProThrSerSerSerThrGlyAsn 151015 ThrMetLysGluValLysSerLeuLeuLeuAspLeuGlnL euLeuLeu 202530 GluLysValLysAsnProGluAsnLeuLysLeuSerArgMetHisThr 354045 PheAspPhe TyrValProLysValAsnAlaThrGluLeuLysHisLeu 505560 LysCysLeuLeuGluGluLeuLysLeuLeuGluGluValLeuAsnLeu 6570 7580 AlaProSerLysAsnLeuAsnProArgGluIleLysAspSerMetAsp 859095 AsnIleLysArgIleValLeuGluLeuGl nGlySerGluThrArgPhe 100105110 ThrCysGluTyrAspAspAlaThrValAsnAlaValGluPheLeuAsn 11512012 5 LysTrpIleThrPheCysGlnSerIleTyrSerThrMetThrGlyAsp 130135140 LeuSerPheProArgLeuThrThrLeuSerAsnGlyLeuLysAsnThr 145 150155160 LeuThrAlaThrLysSerGlyLeuHisLysAlaGlyGlnSerLeuThr 165170175 GlnAlaGlySerSerLeu LysThrGlyAlaLysLysIleIleLeuTyr 180185190 IleProGlnAsnTyrGlnTyrAspThrGluGlnGlyAsnGlyLeuGln 195200 205 AspLeuValLysAlaAlaGluGluLeuGlyIleGluValGlnArgGlu 210215220 GluArgAsnAsnIleAlaThrAlaGlnThrSerLeuGlyThrIleGln 2 25230235240 ThrAlaIleGlyLeuThrGluArgGlyIleValLeuSerAlaProGln 245250255 IleAsp LysLeuLeuGlnLysThrLysAlaGlyGlnAlaLeuGlySer 260265270 AlaGluSerIleValGlnAsnAlaAsnLysAlaLysThrValLeuSer 275 280285 GlyIleGlnSerIleLeuGlySerValLeuAlaGlyMetAspLeuAsp 290295300 GluAlaLeuGlnAsnAsnSerAsnGlnHisAlaLeuAla LysAlaGly 305310315320 LeuGluLeuThrAsnSerLeuIleGluAsnIleAlaAsnSerValLys 325330 335 ThrLeuAspGluPheGlyGluGlnIleSerGlnPheGlySerLysLeu 340345350 GlnAsnIleLysGlyLeuGlyThrLeuGlyAspLysLeuLysAsnIle 355360365 GlyGlyLeuAspLysAlaGlyLeuGlyLeuAspValIleSerGlyLeu 370375380 LeuSerGlyAlaThrAlaAlaLeuVal LeuAlaAspLysAsnAlaSer 385390395400 ThrAlaLysLysValGlyAlaGlyPheGluLeuAlaAsnGlnValVal 405410 415 GlyAsnIleThrLysAlaValSerSerTyrIleLeuAlaGlnArgVal 420425430 AlaAlaGlyLeuSerSerThrGlyProValAlaAlaLeuIle AlaSer 435440445 ThrValSerLeuAlaIleSerProLeuAlaPheAlaGlyIleAlaAsp 450455460 LysPheAsnHisAlaL ysSerLeuGluSerTyrAlaGluArgPheLys 465470475480 LysLeuGlyTyrAspGlyAspAsnLeuLeuAlaGluTyrGlnArgGly 485 490495 ThrGlyThrIleAspAlaSerValThrAlaIleAsnThrAlaLeuAla 500505510 AlaIleAlaGlyGlyValSerAlaAlaAla AlaGlySerValIleAla 515520525 SerProIleAlaLeuLeuValSerGlyIleThrGlyValIleSerThr 530535540 IleLe uGlnTyrSerLysGlnAlaMetPheGluHisValAlaAsnLys 545550555560 IleHisAsnLysIleValGluTrpGluLysAsnAsnHisGlyLysAsn 565570575 TyrPheGluAsnGlyTyrAspAlaArgTyrLeuAlaAsnLeuGlnAsp 580585590 AsnMetLysPheLeuLeuA snLeuAsnLysGluLeuGlnAlaGluArg 595600605 ValIleAlaIleThrGlnGlnGlnTrpAspAsnAsnIleGlyAspLeu 610615 620 AlaGlyIleSerArgLeuGlyGluLysValLeuSerGlyLysAlaTyr 625630635640 ValAspAlaPheGluGluGlyLysHisIleLysAlaAspLysLeu Val 645650655 GlnLeuAspSerAlaAsnGlyIleIleAspValSerAsnSerGlyLys 660665670 AlaLysTh rGlnHisIleLeuPheArgThrProLeuLeuThrProGly 675680685 ThrGluHisArgGluArgValGlnThrGlyLysTyrGluTyrIleThr 69069 5700 LysLeuAsnIleAsnArgValAspSerTrpLysIleThrAspGlyAla 705710715720 AlaSerSerThrPheAspLeuThrAsnValValG lnArgIleGlyIle 725730735 GluLeuAspAsnAlaGlyAsnValThrLysThrLysGluThrLysIle 7407457 50 IleAlaLysLeuGlyGluGlyAspAspAsnValPheValGlySerGly 755760765 ThrThrGluIleAspGlyGlyGluGlyTyrAspArgValHisTyrSer 770 775780 ArgGlyAsnTyrGlyAlaLeuThrIleAspAlaThrLysGluThrGlu 785790795800 GlnGlySerTyrThrValAsnAr gPheValGluThrGlyLysAlaLeu 805810815 HisGluValThrSerThrHisThrAlaLeuValGlyAsnArgGluGlu 820825 830 LysIleGluTyrArgHisSerAsnAsnGlnHisHisAlaGlyTyrTyr 835840845 ThrLysAspThrLeuLysAlaValGluGluIleIleGlyThrSerH is 850855860 AsnAspIlePheLysGlySerLysPheAsnAspAlaPheAsnGlyGly 865870875880 AspGlyValAsp ThrIleAspGlyAsnAspGlyAsnAspArgLeuPhe 885890895 GlyGlyLysGlyAspAspIleLeuAspGlyGlyAsnGlyAspAspPhe 900 905910 IleAspGlyGlyLysGlyAsnAspLeuLeuHisGlyGlyLysGlyAsp 915920925 AspIlePheValHisArgLysGlyAspGlyAsnAs pIleIleThrAsp 930935940 SerAspGlyAsnAspLysLeuSerPheSerAspSerAsnLeuLysAsp 945950955960 LeuThrPheGluLysValLysHisAsnLeuValIleThrAsnSerLys 965970975 LysGluLysValThrIleGlnAsnTrpPheArgGluAlaAspPheAla 980985990 LysGluValProAsnTyrLysAlaThrLysAspGluLysIleGluGlu 99510001005 IleIleGlyGlnAsnGlyGluAr gIleThrSerLysGlnValAspAsp 101010151020 LeuIleAlaLysGlyAsnGlyLysIleThrGlnAspGluLeuSerLys 102510301035 1040 ValValAspAsnTyrGluLeuLeuLysHisSerLysAsnValThrAsn 104510501055 SerLeuAspLysLeuIleSerSerValSerAlaPheThrSe rSerAsn 106010651070 AspSerArgAsnValLeuValAlaProThrSerMetLeuAspGlnSer 107510801085 LeuSerSe rLeuGlnPheAlaArgGlySer 10901095 (2) INFORMATION FOR SEQ ID NO:8: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 3229 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..3207 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8: ATGGCTACTGTTATAGATCTAAGCTTCCCAAAAACTGGGGCAAAAAAA48 MetAlaThrValIleAspLeuSerPheProLysThrGlyAlaLysLys 1510 15 ATTATCCTCTATATTCCCCAAAATTACCAATATGATACTGAACAAGGT96 IleIleLeuTyrIleProGlnAsnTyrGlnTyrAspThrGluGlnGly 2025 30 AATGGTTTACAGGATTTAGTCAAAGCGGCCGAAGAGTTGGGGATTGAG144 AsnGlyLeuGlnAspLeuValLysAlaAlaGluGluLeuGlyIleGlu 3540 45 GTACAAAGAGAAGAACGCAATAATATTGCAACAGCTCAAACCAGTTTA192 ValGlnArgGluGluArgAsnAsnIleAlaThrAlaGlnThrSerLeu 505560 GGCACGATTCAAACCGCTATTGGCTTAACTGAGCGTGGCATTGTGTTA240 GlyThrIleGlnThrAlaIleGlyLeuThrGluArgGlyIleValLeu 657075 80 TCCGCTCCACAAATTGATAAATTGCTACAGAAAACTAAAGCAGGCCAA288 SerAlaProGlnIleAspLysLeuLeuGlnLysThrLysAlaGlyGln 8590 95 GCATTAGGTTCTGCCGAAAGCATTGTACAAAATGCAAATAAAGCCAAA336 AlaLeuGlySerAlaGluSerIleValGlnAsnAlaAsnLysAlaLys 100105110 ACTGTATTATCTGGCATTCAATCTATTTTAGGCTCAGTATTGGCTGGA384 ThrValLeuSerGlyIleGlnSerIleLeuGlySerValLeuAlaGly 115120125 ATG GATTTAGATGAGGCCTTACAGAATAACAGCAACCAACATGCTCTT432 MetAspLeuAspGluAlaLeuGlnAsnAsnSerAsnGlnHisAlaLeu 130135140 GCTAAAGCTGGC TTGGAGCTAACAAATTCATTAATTGAAAATATTGCT480 AlaLysAlaGlyLeuGluLeuThrAsnSerLeuIleGluAsnIleAla 145150155160 AATTCAGT AAAAACACTTGACGAATTTGGTGAGCAAATTAGTCAATTT528 AsnSerValLysThrLeuAspGluPheGlyGluGlnIleSerGlnPhe 165170175 GGTTCAA AACTACAAAATATCAAAGGCTTAGGGACTTTAGGAGACAAA576 GlySerLysLeuGlnAsnIleLysGlyLeuGlyThrLeuGlyAspLys 180185190 CTCAAAAAT ATCGGTGGACTTGATAAAGCTGGCCTTGGTTTAGATGTT624 LeuLysAsnIleGlyGlyLeuAspLysAlaGlyLeuGlyLeuAspVal 195200205 ATCTCAGGGCTATTA TCGGGCGCAACAGCTGCACTTGTACTTGCAGAT672 IleSerGlyLeuLeuSerGlyAlaThrAlaAlaLeuValLeuAlaAsp 210215220 AAAAATGCTTCAACAGCTAAAAA AGTGGGTGCGGGTTTTGAATTGGCA720 LysAsnAlaSerThrAlaLysLysValGlyAlaGlyPheGluLeuAla 225230235240 AACCAAGTTGTTGGTAATA TTACCAAAGCCGTTTCTTCTTACATTTTA768 AsnGlnValValGlyAsnIleThrLysAlaValSerSerTyrIleLeu 245250255 GCCCAACGTGTTGCAGCA GGTTTATCTTCAACTGGGCCTGTGGCTGCT816 AlaGlnArgValAlaAlaGlyLeuSerSerThrGlyProValAlaAla 260265270 TTAATTGCTTCTACTGTTTCT CTTGCGATTAGCCCATTAGCATTTGCC864 LeuIleAlaSerThrValSerLeuAlaIleSerProLeuAlaPheAla 275280285 GGTATTGCCGATAAATTTAATCATGC AAAAAGTTTAGAGAGTTATGCC912 GlyIleAlaAspLysPheAsnHisAlaLysSerLeuGluSerTyrAla 290295300 GAACGCTTTAAAAAATTAGGCTATGACGGAGATA ATTTATTAGCAGAA960 GluArgPheLysLysLeuGlyTyrAspGlyAspAsnLeuLeuAlaGlu 305310315320 TATCAGCGGGGAACAGGGACTATTGATGCA TCGGTTACTGCAATTAAT1008 TyrGlnArgGlyThrGlyThrIleAspAlaSerValThrAlaIleAsn 325330335 ACCGCATTGGCCGCTATTGCTGGTGGTGTG TCTGCTGCTGCAGCCGGC1056 ThrAlaLeuAlaAlaIleAlaGlyGlyValSerAlaAlaAlaAlaGly 340345350 TCGGTTATTGCTTCACCGATTGCCTTATTAGT ATCTGGGATTACCGGT1104 SerValIleAlaSerProIleAlaLeuLeuValSerGlyIleThrGly 355360365 GTAATTTCTACGATTCTGCAATATTCTAAACAAGCAA TGTTTGAGCAC1152 ValIleSerThrIleLeuGlnTyrSerLysGlnAlaMetPheGluHis 370375380 GTTGCAAATAAAATTCATAACAAAATTGTAGAATGGGAAAAAAAT AAT1200 ValAlaAsnLysIleHisAsnLysIleValGluTrpGluLysAsnAsn 385390395400 CACGGTAAGAACTACTTTGAAAATGGTTACGATGCCCGTTAT CTTGCG1248 HisGlyLysAsnTyrPheGluAsnGlyTyrAspAlaArgTyrLeuAla 405410415

AATTTACAAGATAATATGAAATTCTTACTGAACTTAAACAA AGAGTTA1296 AsnLeuGlnAspAsnMetLysPheLeuLeuAsnLeuAsnLysGluLeu 420425430 CAGGCAGAACGTGTCATCGCTATTACTCAGCAGCAATGGGATA ACAAC1344 GlnAlaGluArgValIleAlaIleThrGlnGlnGlnTrpAspAsnAsn 435440445 ATTGGTGATTTAGCTGGTATTAGCCGTTTAGGTGAAAAAGTCCTTAGT 1392 IleGlyAspLeuAlaGlyIleSerArgLeuGlyGluLysValLeuSer 450455460 GGTAAAGCCTATGTGGATGCGTTTGAAGAAGGCAAACACATTAAAGCC1440 G lyLysAlaTyrValAspAlaPheGluGluGlyLysHisIleLysAla 465470475480 GATAAATTAGTACAGTTGGATTCGGCAAACGGTATTATTGATGTGAGT14 88 AspLysLeuValGlnLeuAspSerAlaAsnGlyIleIleAspValSer 485490495 AATTCGGGTAAAGCGAAAACTCAGCATATCTTATTCAGAACGCCATTA1 536 AsnSerGlyLysAlaLysThrGlnHisIleLeuPheArgThrProLeu 500505510 TTGACGCCGGGAACAGAGCATCGTGAACGCGTACAAACAGGTAAATAT1584 LeuThrProGlyThrGluHisArgGluArgValGlnThrGlyLysTyr 515520525 GAATATATTACCAAGCTCAATATTAACCGTGTAGATAGCTGGAAAATT1632 GluT yrIleThrLysLeuAsnIleAsnArgValAspSerTrpLysIle 530535540 ACAGATGGTGCAGCAAGTTCTACCTTTGATTTAACTAACGTTGTTCAG1680 ThrAspGlyAla AlaSerSerThrPheAspLeuThrAsnValValGln 545550555560 CGTATTGGTATTGAATTAGACAATGCTGGAAATGTAACTAAAACCAAA1728 ArgIleGly IleGluLeuAspAsnAlaGlyAsnValThrLysThrLys 565570575 GAAACAAAAATTATTGCCAAACTTGGTGAAGGTGATGACAACGTATTT1776 GluThrLy sIleIleAlaLysLeuGlyGluGlyAspAspAsnValPhe 580585590 GTTGGTTCTGGTACGACGGAAATTGATGGCGGTGAAGGTTACGACCGA1824 ValGlySerG lyThrThrGluIleAspGlyGlyGluGlyTyrAspArg 595600605 GTTCACTATAGCCGTGGAAACTATGGTGCTTTAACTATTGATGCAACC1872 ValHisTyrSerArg GlyAsnTyrGlyAlaLeuThrIleAspAlaThr 610615620 AAAGAGACCGAGCAAGGTAGTTATACCGTAAATCGTTTCGTAGAAACC1920 LysGluThrGluGlnGlySerTyr ThrValAsnArgPheValGluThr 625630635640 GGTAAAGCACTACACGAAGTGACTTCAACCCATACCGCATTAGTGGGC1968 GlyLysAlaLeuHisGluVa lThrSerThrHisThrAlaLeuValGly 645650655 AACCGTGAAGAAAAAATAGAATATCGTCATAGCAATAACCAGCACCAT2016 AsnArgGluGluLysIleG luTyrArgHisSerAsnAsnGlnHisHis 660665670 GCCGGTTATTACACCAAAGATACCTTGAAAGCTGTTGAAGAAATTATC2064 AlaGlyTyrTyrThrLysAsp ThrLeuLysAlaValGluGluIleIle 675680685 GGTACATCACATAACGATATCTTTAAAGGTAGTAAGTTCAATGATGCC2112 GlyThrSerHisAsnAspIlePheLys GlySerLysPheAsnAspAla 690695700 TTTAACGGTGGTGATGGTGTCGATACTATTGACGGTAACGACGGCAAT2160 PheAsnGlyGlyAspGlyValAspThrIleAspGl yAsnAspGlyAsn 705710715720 GACCGCTTATTTGGTGGTAAAGGCGATGATATTCTCGATGGTGGAAAT2208 AspArgLeuPheGlyGlyLysGlyAspAspI leLeuAspGlyGlyAsn 725730735 GGTGATGATTTTATCGATGGCGGTAAAGGCAACGACCTATTACACGGT2256 GlyAspAspPheIleAspGlyGlyLysGly AsnAspLeuLeuHisGly 740745750 GGCAAGGGCGATGATATTTTCGTTCACCGTAAAGGCGATGGTAATGAT2304 GlyLysGlyAspAspIlePheValHisArgLys GlyAspGlyAsnAsp 755760765 ATTATTACCGATTCTGACGGCAATGATAAATTATCATTCTCTGATTCG2352 IleIleThrAspSerAspGlyAsnAspLysLeuSerPh eSerAspSer 770775780 AACTTAAAAGATTTAACATTTGAAAAAGTTAAACATAATCTTGTCATC2400 AsnLeuLysAspLeuThrPheGluLysValLysHisAsnLeuValI le 785790795800 ACGAATAGCAAAAAAGAGAAAGTGACCATTCAAAACTGGTTCCGAGAG2448 ThrAsnSerLysLysGluLysValThrIleGlnAsnTrpPhe ArgGlu 805810815 GCTGATTTTGCTAAAGAAGTGCCTAATTATAAAGCAACTAAAGATGAG2496 AlaAspPheAlaLysGluValProAsnTyrLysAlaThrLys AspGlu 820825830 AAAATCGAAGAAATCATCGGTCAAAATGGCGAGCGGATCACCTCAAAG2544 LysIleGluGluIleIleGlyGlnAsnGlyGluArgIleThrSe rLys 835840845 CAAGTTGATGATCTTATCGCAAAAGGTAACGGCAAAATTACCCAAGAT2592 GlnValAspAspLeuIleAlaLysGlyAsnGlyLysIleThrGlnAsp 850855860 GAGCTATCAAAAGTTGTTGATAACTATGAATTGCTCAAACATAGCAAA2640 GluLeuSerLysValValAspAsnTyrGluLeuLeuLysHisSerLys 865 870875880 AATGTGACAAACAGCTTAGATAAGTTAATCTCATCTGTAAGTGCATTT2688 AsnValThrAsnSerLeuAspLysLeuIleSerSerValSerAlaPhe 885890895 ACCTCGTCTAATGATTCGAGAAATGTATTAGTGGCTCCAACTTCAATG2736 ThrSerSerAsnAspSerArgAsnValLeuValAlaProThrSerMet 900905910 TTGGATCAAAGTTTATCTTCTCTTCAATTTGCTAGGGGATCCCAGGGC2784 LeuAspGlnSerLeuSerSerLeuGlnPheAlaArgGlySerGlnGly 915920925 CAATTTTTTAGAGAAATAGAAAACTTAAAGGAGTATTTTAATGCAAGT2832 GlnPhePheArgGluIleGluAsnLeuLysGluTyrPheAsnAlaSer 930 935940 AGCCCAGATGTAGCTAAGGGTGGGCCTCTCTTCTCAGAAATTTTGAAG2880 SerProAspValAlaLysGlyGlyProLeuPheSerGluIleLeuLys 945950 955960 AATTGGAAAGATGAAAGTGACAAAAAAATTATTCAGAGCCAAATTGTC2928 AsnTrpLysAspGluSerAspLysLysIleIleGlnSerGlnIleVal 965 970975 TCCTTCTACTTCAAACTCTTTGAAAACCTCAAAGATAACCAGGTCATT2976 SerPheTyrPheLysLeuPheGluAsnLeuLysAspAsnGlnValIle 980 985990 CAAAGGAGCATGGATATCATCAAGCAAGACATGTTTCAGAAGTTCTTG3024 GlnArgSerMetAspIleIleLysGlnAspMetPheGlnLysPheLeu 995 10001005 AATGGCAGCTCTGAGAAACTGGAGGACTTCAAAAAGCTGATTCAAATT3072 AsnGlySerSerGluLysLeuGluAspPheLysLysLeuIleGlnIle 10101015 1020 CCGGTGGATGATCTGCAGATCCAGCGCAAAGCCATAAATGAACTCATC3120 ProValAspAspLeuGlnIleGlnArgLysAlaIleAsnGluLeuIle 10251030 10351040 AAAGTGATGAATGACCTGTCACCAAAATCTAACCTCAGAAAGCGGAAG3168 LysValMetAsnAspLeuSerProLysSerAsnLeuArgLysArgLys 1045 10501055 AGAAGTCAGAATCTCTTTCGAGGCCGGAGAGCATCAACGTAATGGTCCT3217 ArgSerGlnAsnLeuPheArgGlyArgArgAlaSerThr 10601065 CCTG CCTGCAAT3229 (2) INFORMATION FOR SEQ ID NO:9: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1069 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9: MetAlaThrValIle AspLeuSerPheProLysThrGlyAlaLysLys 151015 IleIleLeuTyrIleProGlnAsnTyrGlnTyrAspThrGluGlnGly 20 2530 AsnGlyLeuGlnAspLeuValLysAlaAlaGluGluLeuGlyIleGlu 354045 ValGlnArgGluGluArgAsnAsnIleAlaThrAlaGln ThrSerLeu 505560 GlyThrIleGlnThrAlaIleGlyLeuThrGluArgGlyIleValLeu 65707580 SerA laProGlnIleAspLysLeuLeuGlnLysThrLysAlaGlyGln 859095 AlaLeuGlySerAlaGluSerIleValGlnAsnAlaAsnLysAlaLys 1 00105110 ThrValLeuSerGlyIleGlnSerIleLeuGlySerValLeuAlaGly 115120125 MetAspLeuAspGluAlaLeuGlnAsn AsnSerAsnGlnHisAlaLeu 130135140 AlaLysAlaGlyLeuGluLeuThrAsnSerLeuIleGluAsnIleAla 145150155 160 AsnSerValLysThrLeuAspGluPheGlyGluGlnIleSerGlnPhe 165170175 GlySerLysLeuGlnAsnIleLysGlyLeuGlyThrLeuGlyAspLys 180185190 LeuLysAsnIleGlyGlyLeuAspLysAlaGlyLeuGlyLeuAspVal 195200205 IleSerGlyLeuLeuS erGlyAlaThrAlaAlaLeuValLeuAlaAsp 210215220 LysAsnAlaSerThrAlaLysLysValGlyAlaGlyPheGluLeuAla 2252302 35240 AsnGlnValValGlyAsnIleThrLysAlaValSerSerTyrIleLeu 245250255 AlaGlnArgValAlaAlaGlyLeuSerSerThrGly ProValAlaAla 260265270 LeuIleAlaSerThrValSerLeuAlaIleSerProLeuAlaPheAla 275280285 GlyIl eAlaAspLysPheAsnHisAlaLysSerLeuGluSerTyrAla 290295300 GluArgPheLysLysLeuGlyTyrAspGlyAspAsnLeuLeuAlaGlu 305310 315320 TyrGlnArgGlyThrGlyThrIleAspAlaSerValThrAlaIleAsn 325330335 ThrAlaLeuAlaAlaIleAlaGlyG lyValSerAlaAlaAlaAlaGly 340345350 SerValIleAlaSerProIleAlaLeuLeuValSerGlyIleThrGly 355360 365 ValIleSerThrIleLeuGlnTyrSerLysGlnAlaMetPheGluHis 370375380 ValAlaAsnLysIleHisAsnLysIleValGluTrpGluLysAsnAsn 385 390395400 HisGlyLysAsnTyrPheGluAsnGlyTyrAspAlaArgTyrLeuAla 405410415 AsnLeuGlnAspAs nMetLysPheLeuLeuAsnLeuAsnLysGluLeu 420425430 GlnAlaGluArgValIleAlaIleThrGlnGlnGlnTrpAspAsnAsn 43544 0445 IleGlyAspLeuAlaGlyIleSerArgLeuGlyGluLysValLeuSer 450455460 GlyLysAlaTyrValAspAlaPheGluGluGlyLysHisIleLysA la 465470475480 AspLysLeuValGlnLeuAspSerAlaAsnGlyIleIleAspValSer 485490495 Asn SerGlyLysAlaLysThrGlnHisIleLeuPheArgThrProLeu 500505510 LeuThrProGlyThrGluHisArgGluArgValGlnThrGlyLysTyr 515 520525 GluTyrIleThrLysLeuAsnIleAsnArgValAspSerTrpLysIle 530535540 ThrAspGlyAlaAlaSerSerThrPheAspLeuTh rAsnValValGln 545550555560 ArgIleGlyIleGluLeuAspAsnAlaGlyAsnValThrLysThrLys 565570 575 GluThrLysIleIleAlaLysLeuGlyGluGlyAspAspAsnValPhe 580585590 ValGlySerGlyThrThrGluIleAspGlyGlyGluGlyTyrAspArg 595600605 ValHisTyrSerArgGlyAsnTyrGlyAlaLeuThrIleAspAlaThr 610615620 LysGluThrGluGlnGlySerTyr ThrValAsnArgPheValGluThr 625630635640 GlyLysAlaLeuHisGluValThrSerThrHisThrAlaLeuValGly 645 650655 AsnArgGluGluLysIleGluTyrArgHisSerAsnAsnGlnHisHis 660665670 AlaGlyTyrTyrThrLysAspThrLeuLysAlaValGl uGluIleIle 675680685 GlyThrSerHisAsnAspIlePheLysGlySerLysPheAsnAspAla 690695700 PheAsnGlyGly AspGlyValAspThrIleAspGlyAsnAspGlyAsn 705710715720 AspArgLeuPheGlyGlyLysGlyAspAspIleLeuAspGlyGlyAsn 725 730735 GlyAspAspPheIleAspGlyGlyLysGlyAsnAspLeuLeuHisGly 740745750 GlyLysGlyAspAspIlePheValHis ArgLysGlyAspGlyAsnAsp 755760765 IleIleThrAspSerAspGlyAsnAspLysLeuSerPheSerAspSer 770775780 A snLeuLysAspLeuThrPheGluLysValLysHisAsnLeuValIle 785790795800 ThrAsnSerLysLysGluLysValThrIleGlnAsnTrpPheArgGlu 805810815 AlaAspPheAlaLysGluValProAsnTyrLysAlaThrLysAspGlu 820825830 LysIleGluGluIle IleGlyGlnAsnGlyGluArgIleThrSerLys 835840845 GlnValAspAspLeuIleAlaLysGlyAsnGlyLysIleThrGlnAsp 850855 860 GluLeuSerLysValValAspAsnTyrGluLeuLeuLysHisSerLys 865870875880 AsnValThrAsnSerLeuAspLysLeuIleSerSerValSer AlaPhe 885890895 ThrSerSerAsnAspSerArgAsnValLeuValAlaProThrSerMet 900905910 LeuA spGlnSerLeuSerSerLeuGlnPheAlaArgGlySerGlnGly 915920925 GlnPhePheArgGluIleGluAsnLeuLysGluTyrPheAsnAlaSer 930 935940 SerProAspValAlaLysGlyGlyProLeuPheSerGluIleLeuLys 945950955960

AsnTrpLysAspGluSerAspLysLysIle IleGlnSerGlnIleVal 965970975 SerPheTyrPheLysLeuPheGluAsnLeuLysAspAsnGlnValIle 980985 990 GlnArgSerMetAspIleIleLysGlnAspMetPheGlnLysPheLeu 99510001005 AsnGlySerSerGluLysLeuGluAspPheLysLysLeuIleGlnIle 1 01010151020 ProValAspAspLeuGlnIleGlnArgLysAlaIleAsnGluLeuIle 1025103010351040 LysValMetAsnAspLe uSerProLysSerAsnLeuArgLysArgLys 104510501055 ArgSerGlnAsnLeuPheArgGlyArgArgAlaSerThr 10601065 Information displayed is queried directly from the U.S. Patent Office